Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Gene Name SEC61B
Plot displaying the genomic locations of a parental gene (in chr9) and its retrocopy(ies). Each line represents a retrocopy.
Specie Homo sapiens
Full Name SEC61 translocon subunit beta
Also known as -
Coordinate chr9:99222282-99230615
Strand +
Gene summary The Sec61 complex is the central component of the protein translocation apparatus of the endoplasmic reticulum (ER) membrane. Oligomers of the Sec61 complex form a transmembrane channel where proteins are translocated across and integrated into the ER membrane. This complex consists of three membrane proteins- alpha, beta, and gamma. This gene encodes the beta-subunit protein. The Sec61 subunits are also observed in the post-ER compartment, suggesting that these proteins can escape the ER and recycle back. There is evidence for multiple polyadenylated sites for this transcript. [provided by RefSeq, Jul 2008]

Retrocopy(s) from SEC61B

Retroname Coord Strand Genomic Region ENSG
SEC61BP1 chr11:47905127-47905689 - Intergenic
 ENSG00000254780 UCSC

Expression

Transcript Sequences

>NM_006808.3
AGTCTCGCCAGCTGCCGGTCTTTCGGGGGCTCCGTAACTTTCTATCCGTCCGCGTCAGCGCCTTGCCACCCTCATCTCCAATATGCCTGGTCCGACCCCCAGTGGCACTAACGTGGGATCCTCAGGGCGCTCTCCCAGCAAAGCAGTGGCCGCCCGGGCGGCGGGATCCACTGTCCGGCAGAGGAAAAATGCCAGCTGTGGGACAAGGAGTGCAGGCCGCACAACCTCGGCAGGCACCGGGGGGATGTGGCGATTCTACACAGAAGATTCACCTGGGCTCAAAGTTGGCCCTGTTCCAGTATTGGTTATGAGTCTTCTGTTCATCGCTTCTGTATTTATGTTGCACATTTGGGGCAAGTACACTCGTTCGTAGATTCAGTTACATCCATCTGTCATCTGAAGAAGGAGGAAAAAACCCAACATTTCTTGGACCAAAAGTATAGTGACTATCTGTTCATGAGAGAAATTTTCTGTAAGCTTGCTGTTTTACAGGGGATTTATCAATAATTGATTTTGAGGAATCAGTTTTTTTCTATGGCTAATAAACTTTTTAATTCACTTATA