Summary

Gene Name	RPL35
Specie	Homo sapiens
Full Name	ribosomal protein L35
Also known as	DBA19|L35
Coordinate	chr9:124857883-124861957
Strand	-
Gene summary	Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L29P family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Retrocopy(s) from RPL35

Retroname	Coord	Strand	Genomic Region	ENSG
RPL35P1	chr1:236981313-236981743	+	Intergenic	ENSG00000237991	UCSC
RPL35P9	chr13:106425763-106426124	+	Intergenic	ENSG00000174418	UCSC
RPL35P10	chr19:3130672-3131437	+	Intergenic	ENSG00000266944	UCSC
RPL35P8	chr22:49213905-49214269	-	Intergenic	ENSG00000226142	UCSC
RPL35P3	chr6:105302433-105302859	-	Intragenic Intragenic	ENSG00000219902	UCSC
RPL35P2	chr6:34263269-34263723	-	Intergenic	ENSG00000220583	UCSC
RPL35P4	chr7:27269314-27269753	-	Intergenic	ENSG00000213783	UCSC
RPL35P5	chr7:66606714-66607121	-	Intergenic	ENSG00000225573	UCSC
RPL35P6	chr8:18774575-18774759	-	Intragenic	ENSG00000244018	UCSC

Expression

Transcript Sequences

>NM_007209.4

CTCTTTCCCTCGGAGCGGGCGGCGGCGTTGGCGGCTTGTGCAGCAATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGAAGAAGGAGGAGCTGCTGAAACAGCTGGACGACCTGAAGGTGGAGCTGTCCCAGCTGCGCGTCGCCAAAGTGACAGGCGGTGCGGCCTCCAAGCTCTCTAAGATCCGAGTCGTCCGGAAATCCATTGCCCGTGTTCTCACAGTTATTAACCAGACTCAGAAAGAAAACCTCAGGAAATTCTACAAGGGCAAGAAGTACAAGCCCCTGGACCTGCGGCCTAAGAAGACACGTGCCATGCGCCGCCGGCTCAACAAGCACGAGGAGAACCTGAAGACCAAGAAGCAGCAGCGGAAGGAGCGGCTGTACCCGCTGCGGAAGTACGCGGTCAAGGCCTGAGGGGCGCATTGTCAATAAAGCACAGCTGGCTGAGA