| Gene Name | Atp5mk |
|
| Specie | Rattus norvegicus | |
| Full Name | ATP synthase membrane subunit K | |
| Also known as | Atp5md|Dapit|Usmg5 | |
| Coordinate | chr1:266859961-266866753 | |
| Strand | - | |
| Gene summary | Part of mitochondrial proton-transporting ATP synthase complex. Human ortholog(s) of this gene implicated in mitochondrial complex V (ATP synthase) deficiency nuclear type 6. Orthologous to human ATP5MK (ATP synthase membrane subunit k). [provided by Alliance of Genome Resources, Apr 2022] |
| Retroname | Coord | Strand | Genomic Region | ENSG | |
|---|---|---|---|---|---|
| Usmg5P1 | chr3:43640902-43641174 | - |
Intergenic |
N/A | UCSC |
| Usmg5P2 | chr8:70516924-70517226 | + |
Intergenic |
N/A | UCSC |
| Usmg5P3 | chr10:43465276-43465585 | - |
Intragenic |
N/A | UCSC |
| Usmg5P4 | chr10:53990516-53990725 | - |
Intergenic |
N/A | UCSC |
| Usmg5P5 | chr10:89187161-89187474 | - |
Intergenic |
N/A | UCSC |
| >NM_133544.1 |
| GTGATTCGGACGAAGAAGATTGAAGTCATGGCTGGTCCAGAAAGTGATGGCCAATTCCAGTTCACTGGTATTAAAAAATATTTCAACTCTTATACCCTCACAGGTAGAATGAATTGTGTCCTGGCCACATATGGAGGCATTGCTTTGTTGGTCCTATACTTTAAGTTAAGGCCTAAAAAAACCCCAGCTGTGAAAGCAACATAAATGGATTTTGAAATGTCTGGCCTTATCTGTTAAGTCCCACGCCTGAAGAAGCTGATGTGAACTCATCATGTAATACTCAATTTGTACAATAAATTATGAACCTGGAAAA |