Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Gene Name Atp5f1e
Plot displaying the genomic locations of a parental gene (in chr3) and its retrocopy(ies). Each line represents a retrocopy.
Specie Rattus norvegicus
Full Name ATP synthase F1 subunit epsilon
Also known as Atp5e
Coordinate chr3:172563105-172566007
Strand -
Gene summary Contributes to ATP hydrolysis activity. Involved in ATP metabolic process. Located in mitochondrial inner membrane. Part of mitochondrial proton-transporting ATP synthase complex, catalytic sector F(1). Human ortholog(s) of this gene implicated in mitochondrial complex V (ATP synthase) deficiency nuclear type 3. Orthologous to several human genes including ATP5F1E (ATP synthase F1 subunit epsilon). [provided by Alliance of Genome Resources, Apr 2022]

Retrocopy(s) from Atp5f1e

Retroname Coord Strand Genomic Region ENSG
Atp5eP1 chr14:83220203-83220565 + Intergenic
 N/A UCSC

Expression

Transcript Sequences

>NM_139099.1
GGGCTCAGGCTACTCTGAAGCGACCCAGCGGTTCTGCCTGACACGCCCCGCTCGAGACACCATGGTGGCGTACTGGCGACAGGCTGGACTCAGCTACATCCGGTTCTCCCAGATCTGTGCAAAAGCAGTGAGGGATGCCCTGAAGACTGAGTTCAAAGCGAACGCTGAGAAGACTTCGGGCACCAGCATAAAAACAGTGAAAATAAAGAAGGAGTAGCCGAGCCTGACTGAAGCCTGACGTGCGGAGTCTTCCAGGTGAAGCATGTGGGCACCTGTTCCGGCAGATGGAGGTCAGCCGTACCTCCTGGAGACAGACACCCATCTTGTTGATGAATTGACTATGCCAATAAATTAACACGGTTCACTCTCGGC