Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Gene Name Coprs
Plot displaying the genomic locations of a parental gene (in chr16) and its retrocopy(ies). Each line represents a retrocopy.
Specie Rattus norvegicus
Full Name coordinator of PRMT5 and differentiation stimulator
Also known as Copr5|RGD1565675
Coordinate chr16:80826681-80831791
Strand +
Gene summary Predicted to enable histone binding activity. Predicted to be involved in histone H4-R3 methylation and muscle organ development. Predicted to act upstream of or within blastocyst hatching. Predicted to be located in cytosol; nucleoplasm; and plasma membrane. Predicted to be active in nucleus. Orthologous to human COPRS (coordinator of PRMT5 and differentiation stimulator). [provided by Alliance of Genome Resources, Apr 2022]

Retrocopy(s) from Coprs

Retroname Coord Strand Genomic Region ENSG
CoprsP1 chrX:58594830-58595376 - Intergenic
N/A UCSC

Expression

Transcript Sequences

>NM_001169121.1
GGGCGCCTGGCTGTGGGCGGCCCGGCATGGACCCTCAGGCAGCCACCGGTCCGGGGCCGGGCGAGCCGAGTGCATGGGAGGCCCCCAGCGCGGAGGCTGGTCTTGCCACAGCTGACCTCTCTGGTGGGGAGACAGAGACTGAGCTAGACGTGGACCGACTAGCCAGTGGAGCTCAGAGCATCCCTACTGACGTTCCTACCCATGCCGAGGGCCCAAGTTCTGAAGAGGAAGGCTTTGCAATGGAGAAGGAAGCGGATGGGGAACTGTATGCCTGGGAGCTGTCAGAAGGTCCAGCCTGCCCACCCATGGAACAGGCTTCTGGTCTTTTTAACGAGGACTGGGACTTGGAGCTGAAAGCGGACCAAGGGAATCCTTACGATGCTGATGACGTCCAAGGGAGCATTTCCCAAGAGATTAAGCCGTGGGTGTGCTGTGCACCACAAGGAGATATGATGTATGACCCCAGTTGGCACCATCCACCCCCACTGATACCACATTACTCCAAGATGGTCTTTGAAACAGGACAGTTTGATGATGCAGAAGACTAAAAGT