Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Gene Name H2AZ1
Plot displaying the genomic locations of a parental gene (in chr4) and its retrocopy(ies). Each line represents a retrocopy.
Specie Homo sapiens
Full Name H2A.Z variant histone 1
Also known as H2A.Z-1|H2A.z|H2A/z|H2AFZ|H2AZ
Coordinate chr4:99948088-99950275
Strand -
Gene summary Histones are basic nuclear proteins that are responsible for the nucleosome structure of the chromosomal fiber in eukaryotes. Nucleosomes consist of approximately 146 bp of DNA wrapped around a histone octamer composed of pairs of each of the four core histones (H2A, H2B, H3, and H4). The chromatin fiber is further compacted through the interaction of a linker histone, H1, with the DNA between the nucleosomes to form higher order chromatin structures. This gene encodes a replication-independent member of the histone H2A family that is distinct from other members of the family. Studies in mice have shown that this particular histone is required for embryonic development and indicate that lack of functional histone H2A leads to embryonic lethality. [provided by RefSeq, Jul 2008]

Retrocopy(s) from H2AZ1

Retroname Coord Strand Genomic Region ENSG
H2AZP5 chr10:77953445-77954551 + Intergenic
ENSG00000234612 UCSC
H2AZP4 chr11:70278547-70279376 - Intragenic
ENSG00000255329 UCSC
H2AZP3 chr13:99215004-99215859 - Intragenic
ENSG00000218502 UCSC
H2AZP1 chr21:44045978-44047146 - Intragenic
ENSG00000213440 UCSC
H2AZP6 chr22:31521126-31521693 - Intragenic
ENSG00000233733 UCSC
H2AZP7 chr8:111621082-111621691 - Intergenic
ENSG00000253156 UCSC
H2AZP2 chr8:70103424-70104231 - Intergenic
ENSG00000253173 UCSC

Expression

Transcript Sequences

>NM_002106.4
GCAGTTTGAATCGCGGTGCGACGAAGGAGTAGGTGGTGGGATCTCACCGTGGGTCCGATTAGCCTTTTCTCTGCCTTGCTTGCTTGAGCTTCAGCGGAATTCGAAATGGCTGGCGGTAAGGCTGGAAAGGACTCCGGAAAGGCCAAGACAAAGGCGGTTTCCCGCTCGCAGAGAGCCGGCTTGCAGTTCCCAGTGGGCCGTATTCATCGACACCTAAAATCTAGGACGACCAGTCATGGACGTGTGGGCGCGACTGCCGCTGTGTACAGCGCAGCCATCCTGGAGTACCTCACCGCAGAGGTACTTGAACTGGCAGGAAATGCATCAAAAGACTTAAAGGTAAAGCGTATTACCCCTCGTCACTTGCAACTTGCTATTCGTGGAGATGAAGAATTGGATTCTCTCATCAAGGCTACAATTGCTGGTGGTGGTGTCATTCCACACATCCACAAATCTCTGATTGGGAAGAAAGGACAACAGAAGACTGTCTAAAGGATGCCTGGATTCCTTGTTATCTCAGGACTCTAAATACTCTAACAGCTGTCCAGTGTTGGTGATTCCAGTGGACTGTATCTCTGTGAAAAACACAATTTTGCCTTTTTGTAATTCTATTTGAGCAAGTTGGAAGTTTAATTAGCTTTCCAACCAACCAAATTTCTGCATTCGAGTCTTAACCATATTTAAGTGTTACTGTGGCTTCAAAGAAGCTATTGATTCTGAAGTAGTGGGTTTTGATTGAGTTGACTGTTTTTAAAAAACTGTTTGGATTTTAATTGTGATGCAGAAGTTATAGTAACAAACATTTGGTTTTGTACAGACATTATTTCCACTCTGGTGGATAAGTTCAATAAAGGTCATATCCCAAA