Summary

Gene Name	Selenoh
Specie	Rattus norvegicus
Full Name	selenoprotein H
Also known as	RGD1563348|Selh
Coordinate	chr3:72070342-72071909
Strand	-
Gene summary	This gene encodes a nucleolar protein, which belongs to the SelWTH family. It functions as an oxidoreductase, and has been shown to protect neurons against UVB-induced damage by inhibiting apoptotic cell death pathways, promote mitochondrial biogenesis and mitochondrial function, and suppress cellular senescence through genome maintenance and redox regulation. This protein is a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2016]

Retrocopy(s) from Selenoh

Retroname	Coord	Strand	Genomic Region	ENSG
RGD1563348P1	chr8:94800760-94801209	+	Intergenic	N/A	UCSC

Expression

Transcript Sequences

>NM_001321292.1

ACTTCCCGTTTGCTGCGAGATTTGAACTTTGCAACTGTGATTCCGGGCAGCTGCTTTCTCCCTCTCGGGTTGCGTCGCCACTTTATTCCTCCAACGCTCCATTCGGAGATCCGAGCCATGGCCCCTCTCGGAAGAAAGCGTAAGGCCGGGGCCGCGCCTATCGAGTCGGCGGACAAGCGCGAGAAACTGGCGGAGGGCGCGGCCGTGGTCATTGAGCATTGTACGAGCTGACGTGTCTACGGCCGCCATGCTGCTGCCCTGAGCCAGGCTCTGCAACTGGAGGCCCCAGAGATATCTGTGCAAGTGAACCGGTCCAAGCCGCGGAGGGGCAGCTTCGAAGTGACGCTGCTGCGCCCGGACAACAGTCGTGTTGAACTCTGGACTGGTATTAAGAAGGGCCCTCCACGAAAGCTCAAATTTCCTGAGCCTCAAGAGATGGTTGAAGAATTGAAGAAGTACCTTTCATAAGAGCTTTCAGTCCCTGGAGATGTTGAAGCATTTATGATGGTGCATGGCCAAACTTAAGCTATGTACCTGAAGCCATAGTTTCTTCCTCACCAGAAGTGATGGTTCAGTTCTGAGGCAGATCTCCAGCAAGGCACTGTAAAAGTGTGTTGATTTGTTTAATAAAAGTTCAAGTATTTGCAAATAAGGATCAAGTTTAAATTTTGTCTTAAAGAATGGATACAACCAA