Summary

Gene Name	MRPL20
Specie	Homo sapiens
Full Name	mitochondrial ribosomal protein L20
Also known as	L20mt|MRP-L20
Coordinate	chr1:1401909-1407293
Strand	-
Gene summary	Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. A pseudogene corresponding to this gene is found on chromosome 21q. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]

Retrocopy(s) from MRPL20

Retroname	Coord	Strand	Genomic Region	ENSG
MRPL20P1	chr21:36994735-36995242	+	Intergenic	ENSG00000215734	UCSC

Expression

Transcript Sequences

>NM_017971.4

ATTTCCGACCCGGGCAAGATGGCAGCGGCGCTGCGCGTGCGTTGTTGAGTGTTCGGGACGCCGGCCTGCAGGCGCCATGGTCTTCCTCACCGCGCAGCTCTGGCTGCGGAATCGCGTCACCGACCGCTACTTTCGGATCCAGGAGGTGCTGAAGCACGCCAGGCACTTCCGGGGAAGGAAAAATCGCTGCTACAGGTTGGCGGTCAGAACCGTGATTCGAGCCTTTGTGAAATGCACCAAAGCCCGATACCTGAAGAAAAAGAACATGAGGACCCTCTGGATTAATCGAATTACAGCTGCTAGCCAGGAACATGGACTGAAGTATCCAGCGCTCATTGGGAATTTAGTTAAGTGCCAGGTGGAGCTCAACAGGAAAGTCCTAGCGGATCTGGCCATCTACGAGCCAAAGACTTTCAAATCTTTGGCTGCCTTGGCCAGTAGGAGGCGACACGAAGGATTTGCTGCTGCCTTGGGGGATGGGAAGGAACCTGAAGGCATTTTTTCCAGAGTGGTGCAGTACCACTGAGGACTGTTGCTGTATTGATTAGGAAAAGAGACAGAGTAATTTGCAGTTTGTTTGATTTATACTTTTGTTTATCTACAACCCAATAACAGACATGAGGGATGGCCCTGTCTCTCTGGGACAGAGCCTCACAGATGATGTCCATGTTTTGTGTGAATGAAACTCAAACACTCTTCA