Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Gene Name RPS5
Plot displaying the genomic locations of a parental gene (in chr19) and its retrocopy(ies). Each line represents a retrocopy.
Specie Homo sapiens
Full Name ribosomal protein S5
Also known as S5
Coordinate chr19:58387269-58394804
Strand +
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S7P family of ribosomal proteins. It is located in the cytoplasm. Variable expression of this gene in colorectal cancers compared to adjacent normal tissues has been observed, although no correlation between the level of expression and the severity of the disease has been found. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Retrocopy(s) from RPS5

Retroname Coord Strand Genomic Region ENSG
RPS5P9 chr1:212823956-212824503 + Intergenic
ENSG00000236905 UCSC
RPS5P3 chr21:33481538-33482262 - Intergenic
ENSG00000215088 UCSC
RPS5P2 chr21:34135389-34135974 - Intragenic
ENSG00000224598 UCSC
RPS5P10 chr6:116258455-116259187 - Intergenic
ENSG00000233558 UCSC
RPS5P11 chr8:80300796-80301515 + Intergenic
ENSG00000213791 UCSC
RPS5P12 chr9:4781424-4782149 - Intergenic
ENSG00000220105 UCSC
RPS5P7 chrX:109853285-109853952 + Intergenic
ENSG00000225381 UCSC
RPS5P8 chrX:6422054-6422764 - Intergenic
ENSG00000237730 UCSC

Expression

Transcript Sequences

>NM_001009.4
CTCTTCCTGTCTGTACCAGGGCGGCGCGTGGTCTACGCCGAGTGACAGAGACGCTCAGGCTGTGTTCTCAGGATGACCGAGTGGGAGACAGCAGCACCAGCGGTGGCAGAGACCCCAGACATCAAGCTCTTTGGGAAGTGGAGCACCGATGATGTGCAGATCAATGACATTTCCCTGCAGGATTACATTGCAGTGAAGGAGAAGTATGCCAAGTACCTGCCTCACAGTGCAGGGCGGTATGCCGCCAAACGCTTCCGCAAAGCTCAGTGTCCCATTGTGGAGCGCCTCACTAACTCCATGATGATGCACGGCCGCAACAACGGCAAGAAGCTCATGACTGTGCGCATCGTCAAGCATGCCTTCGAGATCATACACCTGCTCACAGGCGAGAACCCTCTGCAGGTCCTGGTGAACGCCATCATCAACAGTGGTCCCCGGGAGGACTCCACACGCATTGGGCGCGCCGGGACTGTGAGACGACAGGCTGTGGATGTGTCCCCCCTGCGCCGTGTGAACCAGGCCATCTGGCTGCTGTGCACAGGCGCTCGTGAGGCTGCCTTCCGGAACATTAAGACCATTGCTGAGTGCCTGGCAGATGAGCTCATCAATGCTGCCAAGGGCTCCTCGAACTCCTATGCCATTAAGAAGAAGGACGAGCTGGAGCGTGTGGCCAAGTCCAACCGCTGATTTTCCCAGCTGCTGCCCAATAAACCTGTCTGCCCTTTGGGGCAGTCCCAGCCA