Summary

Gene Name	RPS25
Specie	Homo sapiens
Full Name	ribosomal protein S25
Also known as	S25
Coordinate	chr11:119015717-119018343
Strand	-
Gene summary	Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S25E family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Retrocopy(s) from RPS25

Retroname	Coord	Strand	Genomic Region	ENSG
RPS25P10	chr11:27581620-27582100	+	Intergenic	ENSG00000240036	UCSC
RPS25P4	chr1:211173417-211173897	+	Intergenic	ENSG00000234004	UCSC
RPS25P3	chr2:20606233-20606669	-	Intragenic	ENSG00000233416	UCSC
RPS25P11	chr22:43092171-43092579	+	Intergenic	ENSG00000234735	UCSC
RPS25P6	chr3:149357131-149357550	-	Intergenic	ENSG00000243822	UCSC
RPS25P5	chr3:53474657-53474919	-	Intergenic	ENSG00000227224	UCSC
RPS25P7	chr5:116051863-116052342	-	Intragenic	ENSG00000185641	UCSC
RPS25P8	chr6:3913875-3914289	-	Intergenic	ENSG00000218472	UCSC
RPS25P9	chr9:123029331-123029768	-	Intragenic	ENSG00000213216	UCSC

Expression

Transcript Sequences

>NM_001028.3_2

CTTTTTGTCCGACATCTTGACGAGGCTGCGGTGTCTGCTGCTATTCTCCGAGCTTCGCAATGCCGCCTAAGGACGACAAGAAGAAGAAGGACGCTGGAAAGTCGGCCAAGAAAGACAAAGACCCAGTGAACAAATCCGGGGGCAAGGCCAAAAAGAAGAAGTGGTCCAAAGGCAAAGTTCGGGACAAGCTCAATAACTTAGTCTTGTTTGACAAAGCTACCTATGATAAACTCTGTAAGGAAGTTCCCAACTATAAACTTATAACCCCAGCTGTGGTCTCTGAGAGACTGAAGATTCGAGGCTCCCTGGCCAGGGCAGCCCTTCAGGAGCTCCTTAGTAAAGGACTTATCAAACTGGTTTCAAAGCACAGAGCTCAAGTAATTTACACCAGAAATACCAAGGGTGGAGATGCTCCAGCTGCTGGTGAAGATGCATGAATAGGTCCAACCAGCTGTACATTTGGAAAAATAAAACTTTATTAAA