Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Gene Name Ifitm3
Plot displaying the genomic locations of a parental gene (in chr7) and its retrocopy(ies). Each line represents a retrocopy.
Specie Mus musculus
Full Name interferon induced transmembrane protein 3
Also known as 1110004C05Rik|Cd225|Cdw217|DSPA2b|Fgls|IP15|mil-1
Coordinate chr7:140589503-140590657
Strand -
Gene summary Involved in negative regulation of viral entry into host cell and response to virus. Acts upstream of or within defense response to other organism; negative regulation of cell population proliferation; and receptor-mediated endocytosis. Located in several cellular components, including apical part of cell; cell surface; and endoplasmic reticulum. Is expressed in several structures, including alimentary system; egg cylinder; embryo ectoderm; genitourinary system; and mesenchyme derived from lateral plate. Human ortholog(s) of this gene implicated in COVID-19; adenosquamous gallbladder carcinoma; and gallbladder adenocarcinoma. Orthologous to several human genes including IFITM3 (interferon induced transmembrane protein 3). [provided by Alliance of Genome Resources, Apr 2022]

Retrocopy(s) from Ifitm3

Retroname Coord Strand Genomic Region ENSG
Ifitm3P2 chr17:66312626-66313217 + Intragenic
ENSMUSG00000117074 UCSC
Ifitm3P1 chr9:41075630-41076017 + Intragenic
ENSMUSG00000111337 UCSC

Expression

Transcript Sequences

>NM_025378.2
AGGAAAAGGAAACTTCTGAGAAACCGAAACTGCCGCAGAAAGGGCAGACCCGCAGCGCGCTCCATCCTTTGCCCTTCAGTGCTGCCTTTGCTCCGCACCATGAACCACACTTCTCAAGCCTTCATCACCGCTGCCAGTGGAGGACAGCCCCCAAACTACGAAAGAATCAAGGAAGAATATGAGGTGGCTGAGATGGGGGCACCGCACGGATCGGCTTCTGTCAGAACTACTGTGATCAACATGCCCAGAGAGGTGTCGGTGCCTGACCATGTGGTCTGGTCCCTGTTCAATACACTCTTCATGAACTTCTGCTGCCTGGGCTTCATAGCCTATGCCTACTCCGTGAAGTCTAGGGATCGGAAGATGGTGGGTGATGTGACTGGAGCCCAGGCCTACGCCTCCACTGCTAAGTGCCTGAACATCAGCACCTTGGTCCTCAGCATCCTGATGGTTGTTATCACCATTGTTAGTGTCATCATCATTGTTCTTAACGCTCAAAACCTTCACACTTAATAGAGGATTCCGACTTCCGGTCCTGAAGTGCTTCACCCTCCGCAGCTGCGTCCCTCCTTGCCCCTCCCTACACGCAGGTGTAACACTCATTTATCTATCCACAGTGGATTCAATAAAGTGCACTTGATAACCACC