| Gene Name | Ndufa7 |
|
| Specie | Mus musculus | |
| Full Name | NADH:ubiquinone oxidoreductase subunit A7 | |
| Also known as | 14.5kDa|2400007M02Rik|CI-B14.5a | |
| Coordinate | chr17:34043546-34057290 | |
| Strand | + | |
| Gene summary | This gene encodes a subunit of the NADH-ubiquinone oxidoreductase (complex I) enzyme, which is a large, multimeric protein. It is the first enzyme complex in the mitochondrial electron transport chain and catalyzes the transfer of electrons from NADH to the electron acceptor ubiquinone. The proton gradient created by electron transfer drives the conversion of ADP to ATP. Complex I has been biochemically separated into four fractions. The bovine ortholog of this protein has been reported to be part of the I-lambda fraction, which forms the extrinsic globular domain. In humans, deficiencies in complex I are associated with myopathies, encephalomyopathies, and neurodegenerative disorders. Pseudogenes of this gene are located on chromosomes 7 and 16. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013] |
| Retroname | Coord | Strand | Genomic Region | ENSG | |
|---|---|---|---|---|---|
| Ndufa7P2 | chr16:31805870-31806230 | - |
Intragenic |
ENSMUSG00000081404 | UCSC |
| Ndufa7P1 | chr7:144345696-144346186 | + |
Intergenic |
ENSMUSG00000108874 | UCSC |
| >NM_023202.4 |
| GGTACCCAGGAATCCTCGGGACAGAGTCGTCACCAGCGTCCTTCGGAGCGGAAGGAATATGGCGTCCGCTACTCGCGTTATCCAAAAGCTGCGGAACTGGGCGTCTGGGCAAGACCTGCAGGCGAAGCTACAGCTGCGCTACCAGGAGATCGCCAAGCGGACCCAGCCACCTCCGAAACTCCCCGTGGGCCCCAGTCACAAGCTGTCCAACAATTACTACTGTACTCGTGATGGCCGCCGGGAAGTTGTGCCTCCCTCAATCATCATGTCCTCACAAAAGGCCCTGGTGTCAGGCAAGGCCGCCGAGAGTTCTGCAATGGCAGCCACTGAGAAGAAGGCAGTGACACCTGCTCCTCCCATGAAGAGGTGGGAGCTGTCCAAGGACCAGCCATACCTGTGACCCTGCCCTAGGTTACCTTGCTATATATGTCTCTAGGGCCACATGACTGCTTTTCCTCCTTGGACTCCCTCTGGGGAGAGTGTGACCTAATTTGTAACAAATATATAGAATTCCACATTATTTCCAA |