Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Gene Name Pam16
Plot displaying the genomic locations of a parental gene (in chr10) and its retrocopy(ies). Each line represents a retrocopy.
Specie Rattus norvegicus
Full Name presequence translocase associated motor 16
Also known as Magmas
Coordinate chr10:11146359-11153936
Strand +
Gene summary Involved in negative regulation of apoptotic DNA fragmentation and negative regulation of release of cytochrome c from mitochondria. Predicted to be located in mitochondrial matrix. Predicted to be extrinsic component of mitochondrial inner membrane. Predicted to be part of PAM complex, Tim23 associated import motor. Human ortholog(s) of this gene implicated in spondylometaphyseal dysplasia Megarbane-Dagher-Melike type. Orthologous to human PAM16 (presequence translocase associated motor 16). [provided by Alliance of Genome Resources, Apr 2022]

Retrocopy(s) from Pam16

Retroname Coord Strand Genomic Region ENSG
Pam16P1 chr10:91752859-91753378 + Intragenic
 N/A UCSC

Expression

Transcript Sequences

>NM_001100136.2
CCCACCAGCCACCCTTGAGCTGGTCCCACTGGGTCGGGAAGCGGCACCCGTCCCCGTAAAGTGGAGCGGCCGCCATGGCCAAGTACCTGGCCCAGATCATTGTGATGGGTGTGCAGGTGGTGGGCAGAGCCTTTGCCAGGGCCCTGAGGCAGGAGTTTGCAGCAAGCCAGGCAGCCGCTGATGCTCGAGGCCGTGCTGGGCACCAGTCTGCAGCTGCATCCAATCTCTCTGGCCTCAGCCTCCAGGAAGCCCAGCAGATTCTCAACATCTCTAAGCTGAGCCCTGAGGAGGTGCAGAAGAATTATGAACACCTGTTTAAGGTGAATGATAAGTCCGTGGGTGGCTCTTTCTACCTGCAGTCAAAGGTTGTCCGTGCAAAGGAACGCCTAGATGAGGAACTCCGAATACAAGCCCAGGAAGACAGAGAGAAAGGGCAGACGCCCAAAACGTGACTGCTGGGCTCTCCACACCCACCCATTGCCTCATAATTTATAGCCTAGTAATAAATGTCTTTTCGTGTTT