| Gene Name | Tomm7 |
|
| Specie | Rattus norvegicus | |
| Full Name | translocase of outer mitochondrial membrane 7 | |
| Also known as | - | |
| Coordinate | chr4:7835949-7842790 | |
| Strand | + | |
| Gene summary | Predicted to be involved in positive regulation of mitophagy in response to mitochondrial depolarization; positive regulation of protein targeting to mitochondrion; and regulation of protein stability. Predicted to be located in mitochondrion. Predicted to be part of mitochondrial outer membrane translocase complex. Orthologous to human TOMM7 (translocase of outer mitochondrial membrane 7). [provided by Alliance of Genome Resources, Apr 2022] |
| Retroname | Coord | Strand | Genomic Region | ENSG | |
|---|---|---|---|---|---|
| Tomm7P1 | chr4:157928128-157928441 | + |
Intergenic |
N/A | UCSC |
| Tomm7P2 | chr4:84785465-84785781 | - |
Intragenic |
N/A | UCSC |
| Tomm7P3 | chr5:118226111-118226468 | - |
Intergenic |
N/A | UCSC |
| Tomm7P4 | chr8:97722452-97722640 | - |
Intergenic |
N/A | UCSC |
| Tomm7P5 | chr10:57159191-57159547 | - |
Intergenic |
N/A | UCSC |
| Tomm7P6 | chrX:29060808-29060999 | + |
Intergenic |
N/A | UCSC |
| >NM_001135174.1 |
| CGACGCAGTCTTGGTTGTGGTGGCTCATCGTTCGGCTGGTCCGTCGTCGTCATGGTGAAGCTGAGCAAGGAAGCCAAACAGAGGCTGCAGCAGCTCTTCAAGGGCGGCCAGTTTGCCATCCGCTGGGGCTTTATTCCTCTCGTGATTTACCTGGGATTCACAAGGGGTGCAGATCCTGGAATGCCTGAACCATCAGTTTTAAGCCTACTTTGGGGATAAAGGACTGTTCGGTCATCTGGATCTGGACGCAGTGCAACATGGGAGGTGTGTGCTCCGGCTGGATGAGAAAGGAGACGTCATTTCAACACATCTGAGGCAGAGTGGAGTCTGTACTGACTTACGATAGACTATCAAAATAAATATTTTTAACAATGTTA |