Gene Name | Mif |
|
Specie | Rattus norvegicus | |
Full Name | macrophage migration inhibitory factor | |
Also known as | - | |
Coordinate | chr20:13715219-13732980 | |
Strand | + | |
Gene summary | Predicted to enable several functions, including identical protein binding activity; intramolecular oxidoreductase activity; and receptor ligand activity. Involved in several processes, including positive regulation of transport; response to steroid hormone; and response to vitamin. Located in cytoplasm; extracellular space; and nucleus. Used to study several diseases, including acute necrotizing pancreatitis; cardiomyopathy (multiple); lung disease (multiple); retinitis; and toxic shock syndrome. Biomarker of borna disease; cystitis; kidney disease; myocardial infarction; and type 2 diabetes mellitus. Human ortholog(s) of this gene implicated in allergic disease; asthma; cystic fibrosis; lung disease (multiple); and obesity. Orthologous to human MIF (macrophage migration inhibitory factor). [provided by Alliance of Genome Resources, Apr 2022] |
Retroname | Coord | Strand | Genomic Region | ENSG | |
---|---|---|---|---|---|
MifP1 | chr1:134335589-134336139 | - |
Intergenic |
N/A | UCSC |
MifP2 | chr2:29837999-29838478 | - |
Intergenic |
N/A | UCSC |
MifP3 | chr4:132295951-132296436 | - |
Intergenic |
N/A | UCSC |
MifP4 | chr4:8501928-8502339 | - |
Intragenic |
N/A | UCSC |
MifP5 | chr5:156575698-156576237 | - |
Intergenic |
N/A | UCSC |
MifP6 | chr6:103615891-103616411 | - |
Intergenic |
N/A | UCSC |
MifP7 | chr10:97505016-97505566 | - |
Intergenic |
N/A | UCSC |
MifP8 | chr13:57396931-57397320 | + |
Intragenic |
N/A | UCSC |
MifP9 | chr13:89934673-89935193 | - |
Intergenic |
N/A | UCSC |
MifP10 | chr14:115116795-115117066 | - |
Intergenic |
N/A | UCSC |
MifP11 | chr17:51046432-51046833 | - |
Intergenic |
N/A | UCSC |
MifP12 | chr18:48605750-48605981 | - |
Intergenic |
N/A | UCSC |
MifP13 | chr19:17687772-17688193 | + |
Intergenic |
N/A | UCSC |
MifP14 | chrX:31107198-31107431 | + |
Intergenic |
N/A | UCSC |
>NM_031051.1 |
GGGTCACGTAGCTCAGGTCCCAGACTTGGGTCACACCGCGCTTTACACCGTCCTCCGGCCGTCGCTCGCAGTCTCTCCGCCACCATGCCTATGTTCATCGTGAACACCAATGTTCCCCGCGCCTCCGTGCCAGAGGGGTTTCTCTCCGAGCTCACCCAGCAGCTGGCGCAGGCCACCGGCAAGCCGGCACAGTACATCGCAGTGCACGTGGTCCCGGACCAGCTCATGACTTTTAGTGGCACGAGCGACCCCTGCGCCCTCTGCAGCCTGCACAGCATCGGCAAGATCGGTGGCGCCCAGAACCGCAACTACAGCAAGCTGCTGTGCGGCCTGCTGTCCGATCGCCTGCACATCAGCCCGGACCGGGTCTACATCAACTATTACGACATGAACGCAGCCAACGTGGGCTGGAACGGTTCCACCTTCGCTTGAGCCCGGGCCTCACTTACCTGCACCGCTGTTCTTCGAGTCTTGCTGCACGCCCCGTTCTGTGTTTATCCACCCGTAATGATGGCCACCTTCCGGTCGGGAGAAATAAATGGTTTGAGACCA |