Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Gene Name COX17
Plot displaying the genomic locations of a parental gene (in chr3) and its retrocopy(ies). Each line represents a retrocopy.
Specie Homo sapiens
Full Name cytochrome c oxidase copper chaperone COX17
Also known as -
Coordinate chr3:119669532-119677406
Strand -
Gene summary Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein which is not a structural subunit, but may be involved in the recruitment of copper to mitochondria for incorporation into the COX apoenzyme. This protein shares 92% amino acid sequence identity with mouse and rat Cox17 proteins. This gene is no longer considered to be a candidate gene for COX deficiency. A pseudogene COX17P has been found on chromosome 13. [provided by RefSeq, Jul 2008]

Retrocopy(s) from COX17

Retroname Coord Strand Genomic Region ENSG
COX17P1 chr13:46490856-46491259 + Intergenic
ENSG00000205105 UCSC

Expression

Transcript Sequences

>NM_005694.2
AGAGCGACTGCCGGAAGTGACTGCGGACGAATCGGCGTTTGCCGAGGCTGGCATAGATTTGGCTGTCTCCGCTCATAGCTGCTTTTGGCGCGAAAGATGCCGGGTCTGGTTGACTCAAACCCTGCCCCGCCTGAGTCTCAGGAGAAGAAGCCGCTGAAGCCCTGCTGCGCTTGCCCGGAGACCAAGAAGGCGCGCGATGCGTGTATCATCGAGAAAGGAGAAGAACACTGTGGACATCTAATTGAGGCCCACAAGGAATGCATGAGAGCCCTAGGATTTAAAATATGAAATGGTGGTCTGCTGTGTGAATAAATAATTCCTGAAGAATGAAGAAGATTAATTTTGGGAGTTCTTTGACGAACTTTGATATGTGGAAAAAGTATTTATAATTTATTGTAAGAAGAAAGTAAAATATTACTAGTGGAA