Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name COX17P1
Plot displaying the genomic locations of a retrocopy (in chr13) and its respective parental gene (in chr3). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr13:46490856-46491259  UCSC
Coordinates (T2T) chr13:45711712-45712115  UCSC
Coordinates (hg19) chr13:47064991-47065394  UCSC
Strand +
Parental Sequence NM_005694.2
Parental seq. overlap 396 bp
Parental seq. overlap (%) 93%
Genomic Region Intergenic
Retrocopy Summary COX17P1, located on chr13:46490856-46491259, is a retrocopy of the parental gene COX17. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name COX17
Full Name cytochrome c oxidase copper chaperone COX17
Also known as -
Coordinate chr3:119669532-119677406
Strand -
Gene summary Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein which is not a structural subunit, but may be involved in the recruitment of copper to mitochondria for incorporation into the COX apoenzyme. This protein shares 92% amino acid sequence identity with mouse and rat Cox17 proteins. This gene is no longer considered to be a candidate gene for COX deficiency. A pseudogene COX17P has been found on chromosome 13. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes COX17P1
Bonobo Pan paniscus LOC100970363P1
Gorilla Gorilla gorilla LOC101152722P1
Orangutan Pongo abelii Without Homology
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>COX17P1
TCGGACGAATTGGCGTTTGCCGAGGCTGGCATAGATTTGGCTGTCTCCGCTCATAGCTGCTTTTGGCGCGAAAGATGCCGGGTCTGGTTGACTCAAACCCTGCCCTGCCTGAGTCTCAGGAGAAGAGGCCGCTGAAGCCCTGCTGCACTTGCCCGGAGACCAAGAAGGCACGCGATGCGTGTATCATCGAGAAAGGAGAAGAACACTGTGGACATCTAATTGAGGCCCACAAGGAATGCATGAGAGCCCTAGGATTTAAAATATGAAATGGTGGTCTGCTGTGTGAATAAATAATTCCTGAAGGATGAAGAAGATTAATTTTGGGAGTTCTTTGATGAACTTTGATATGTGGAAAAAGTATTTATAATTTATTGTAAGAAGAAAGTAAAATATTACTAGTGGAA
>NM_005694.2
AGAGCGACTGCCGGAAGTGACTGCGGACGAATCGGCGTTTGCCGAGGCTGGCATAGATTTGGCTGTCTCCGCTCATAGCTGCTTTTGGCGCGAAAGATGCCGGGTCTGGTTGACTCAAACCCTGCCCCGCCTGAGTCTCAGGAGAAGAAGCCGCTGAAGCCCTGCTGCGCTTGCCCGGAGACCAAGAAGGCGCGCGATGCGTGTATCATCGAGAAAGGAGAAGAACACTGTGGACATCTAATTGAGGCCCACAAGGAATGCATGAGAGCCCTAGGATTTAAAATATGAAATGGTGGTCTGCTGTGTGAATAAATAATTCCTGAAGAATGAAGAAGATTAATTTTGGGAGTTCTTTGACGAACTTTGATATGTGGAAAAAGTATTTATAATTTATTGTAAGAAGAAAGTAAAATATTACTAGTGGAA

Publications

PMID - Link Title