Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Gene Name SCGB1D1
Plot displaying the genomic locations of a parental gene (in chr11) and its retrocopy(ies). Each line represents a retrocopy.
Specie Homo sapiens
Full Name secretoglobin family 1D member 1
Also known as LIPA|LPHA|LPNA
Coordinate chr11:62190216-62193539
Strand +
Gene summary The protein encoded by this gene is a member of the lipophilin subfamily, part of the uteroglobin superfamily, and is an ortholog of prostatein, the major secretory glycoprotein of the rat ventral prostate gland. This gene product represents one component of a heterodimeric molecule present in human tears whose elution profile is consistent with prostatein, a tetrameric molecule composed of three peptide components in heterodimers. Assuming that human lipophilins are the functional counterparts of prostatein, they may be transcriptionally regulated by steroid hormones, with the ability to bind androgens, other steroids and possibly bind and concentrate estramustine, a chemotherapeutic agent widely used for prostate cancer. Although the gene has been reported to be on chromosome 15, this sequence appears to be from a cluster of genes on chromosome 11 that includes mammaglobin 2. [provided by RefSeq, Jul 2008]

Retrocopy(s) from SCGB1D1

Retroname Coord Strand Genomic Region ENSG
SCGB1D5P chr4:165517308-165517502 - Intergenic
ENSG00000248287 UCSC

Expression

Transcript Sequences

>NM_006552.2
AGGCTCCCGGGGCTGAGTCTAAATCACTCATCATTGGTTAAAGCCGAGCTCACAGCAGAATAAGCCACCATGAGGCTGTCGGTGTGTCTCCTGCTGCTCACGCTGGCCCTTTGCTGCTACCGGGCAAATGCAGTGGTCTGCCAAGCTCTTGGTTCTGAAATCACAGGCTTCTTATTAGCTGGAAAACCTGTGTTCAAGTTCCAACTTGCCAAATTTAAGGCACCTCTGGAAGCTGTTGCAGCCAAGATGGAAGTGAAGAAATGCGTGGATACGATGGCCTATGAGAAAAGAGTGCTAATTACAAAAACATTGGGAAAAATAGCAGAGAAATGTGATCGCTGAGATGTAAAAAGTTTTTAATGCTAGTTTCCACCATCTTTCAATGATACCCTGATCTTCACTGCAGAATGTAAAGGTTTCAACGTCTTGCTCTAATAAATCACTTGCCCTGAA