| Retrocopy Name | SCGB1D5P |
|
| Species | Homo sapiens | |
| Coordinates (hg38) | chr4:165517308-165517502 UCSC | |
| Coordinates (T2T) | chr4:168863396-168863590 UCSC | |
| Coordinates (hg19) | chr4:166438460-166438654 UCSC | |
| Strand | - | |
| Parental Sequence | NM_006552.2 | |
| Parental seq. overlap | 161 bp | |
| Parental seq. overlap (%) | 35.4% | |
| Genomic Region |
Intergenic |
|
| Retrocopy Summary | SCGB1D5P, located on chr4:165517308-165517502, is a retrocopy of the parental gene SCGB1D1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | SCGB1D1 |
| Full Name | secretoglobin family 1D member 1 |
| Also known as | LIPA|LPHA|LPNA |
| Coordinate | chr11:62190216-62193539 |
| Strand | + |
| Gene summary | The protein encoded by this gene is a member of the lipophilin subfamily, part of the uteroglobin superfamily, and is an ortholog of prostatein, the major secretory glycoprotein of the rat ventral prostate gland. This gene product represents one component of a heterodimeric molecule present in human tears whose elution profile is consistent with prostatein, a tetrameric molecule composed of three peptide components in heterodimers. Assuming that human lipophilins are the functional counterparts of prostatein, they may be transcriptionally regulated by steroid hormones, with the ability to bind androgens, other steroids and possibly bind and concentrate estramustine, a chemotherapeutic agent widely used for prostate cancer. Although the gene has been reported to be on chromosome 15, this sequence appears to be from a cluster of genes on chromosome 11 that includes mammaglobin 2. [provided by RefSeq, Jul 2008] |
| Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | SCGB1D1P1 |
![]() |
Bonobo | Pan paniscus | SCGB1D1P1 |
![]() |
Gorilla | Gorilla gorilla | SCGB1D1P1 |
![]() |
Orangutan | Pongo abelii | SCGB1D1P1 |
![]() |
Gibbon | Nomascus leucogenys | SCGB1D1P1 |
![]() |
Green monkey | Chlorocebus sabaeus | LOC103234130P1 |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >SCGB1D5P |
| CCATGAGGCTGTCAGTCTGCCTCCTACTACTCATTCTGGCCTTTTGCTGCTAGGAGGCCAATGCAGTGCTCTGTCCAGCCCTTGCTACTAAAATCACAGGCTTCTTATTCACTCAGGATCCTCTGTTCAAGTTACAACTTGCCAATCTTAATGCACTTCTGGAAGCTATTGCTGCCAAGATGGCAGTGAAGAAAC |
| >NM_006552.2 |
| AGGCTCCCGGGGCTGAGTCTAAATCACTCATCATTGGTTAAAGCCGAGCTCACAGCAGAATAAGCCACCATGAGGCTGTCGGTGTGTCTCCTGCTGCTCACGCTGGCCCTTTGCTGCTACCGGGCAAATGCAGTGGTCTGCCAAGCTCTTGGTTCTGAAATCACAGGCTTCTTATTAGCTGGAAAACCTGTGTTCAAGTTCCAACTTGCCAAATTTAAGGCACCTCTGGAAGCTGTTGCAGCCAAGATGGAAGTGAAGAAATGCGTGGATACGATGGCCTATGAGAAAAGAGTGCTAATTACAAAAACATTGGGAAAAATAGCAGAGAAATGTGATCGCTGAGATGTAAAAAGTTTTTAATGCTAGTTTCCACCATCTTTCAATGATACCCTGATCTTCACTGCAGAATGTAAAGGTTTCAACGTCTTGCTCTAATAAATCACTTGCCCTGAA |
| PMID - Link | Title |
|---|