Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name SCGB1D5P
Wait
Plot displaying the genomic locations of a retrocopy (in chr4) and its respective parental gene (in chr11). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr4:165517308-165517502  UCSC
Coordinates (T2T) chr4:168863396-168863590  UCSC
Coordinates (hg19) chr4:166438460-166438654  UCSC
Strand -
Parental Sequence NM_006552.2
Parental seq. overlap 161 bp
Parental seq. overlap (%) 35.4%
Genomic Region Intergenic
Retrocopy Summary SCGB1D5P, located on chr4:165517308-165517502, is a retrocopy of the parental gene SCGB1D1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name SCGB1D1
Full Name secretoglobin family 1D member 1
Also known as LIPA|LPHA|LPNA
Coordinate chr11:62190216-62193539
Strand +
Gene summary The protein encoded by this gene is a member of the lipophilin subfamily, part of the uteroglobin superfamily, and is an ortholog of prostatein, the major secretory glycoprotein of the rat ventral prostate gland. This gene product represents one component of a heterodimeric molecule present in human tears whose elution profile is consistent with prostatein, a tetrameric molecule composed of three peptide components in heterodimers. Assuming that human lipophilins are the functional counterparts of prostatein, they may be transcriptionally regulated by steroid hormones, with the ability to bind androgens, other steroids and possibly bind and concentrate estramustine, a chemotherapeutic agent widely used for prostate cancer. Although the gene has been reported to be on chromosome 15, this sequence appears to be from a cluster of genes on chromosome 11 that includes mammaglobin 2. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes SCGB1D1P1
Bonobo Pan paniscus SCGB1D1P1
Gorilla Gorilla gorilla SCGB1D1P1
Orangutan Pongo abelii SCGB1D1P1
Gibbon Nomascus leucogenys SCGB1D1P1
Green monkey Chlorocebus sabaeus LOC103234130P1
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Adipose SubcutaneousMuscle SkeletalArtery TibialArtery CoronaryHeart Atrial AppendageAdipose VisceralUterusVaginaBreast Mammary TissueSkin Not Sun ExposedMinor Salivary GlandBrain CortexAdrenal GlandThyroidLungSpleenPancreasEsophagus MuscularisEsophagus MucosaEsophagus Gastroesophageal JunctionStomachColon SigmoidSmall Intestine Terminal IleumColon TransverseProstateTestisNerve TibialSkin Sun ExposedHeart Left VentricleBrain CerebellumWhole BloodArtery AortaPituitaryBrain Frontal CortexBrain CaudateBrain Nucleus AccumbensBrain PutamenBrain HypothalamusBrain Spinal CordBrain HippocampusBrain Anterior Cingulate CortexOvaryBrain Cerebellar HemisphereLiverBrain Substantia NigraKidney CortexBrain AmygdalaCervix EctocervixFallopian TubeCervix EndocervixBladderKidney Medulla00.10.20.30.4
log10(TPM+1)

Massive Mining of Publicly Available RNA-seq Data from Human and Mouse - (ARCHS4)

AdiposeBone MarrowBreast Mammary TissueBrain CerebellumColonColon Colonic MucosaEsophagusHeartHeart VentricleKidneyLiverBrain MidbrainOvaryPancreasBrain PonsKidney CortexEye RetinaMuscle SkeletalSkinSmall IntestineBrain Spinal CordSpleenTestisThymusTracheaHeart ValveMuscle Smooth0123
log10(TPM+1)

Related Sequence

>SCGB1D5P
CCATGAGGCTGTCAGTCTGCCTCCTACTACTCATTCTGGCCTTTTGCTGCTAGGAGGCCAATGCAGTGCTCTGTCCAGCCCTTGCTACTAAAATCACAGGCTTCTTATTCACTCAGGATCCTCTGTTCAAGTTACAACTTGCCAATCTTAATGCACTTCTGGAAGCTATTGCTGCCAAGATGGCAGTGAAGAAAC
>NM_006552.2
AGGCTCCCGGGGCTGAGTCTAAATCACTCATCATTGGTTAAAGCCGAGCTCACAGCAGAATAAGCCACCATGAGGCTGTCGGTGTGTCTCCTGCTGCTCACGCTGGCCCTTTGCTGCTACCGGGCAAATGCAGTGGTCTGCCAAGCTCTTGGTTCTGAAATCACAGGCTTCTTATTAGCTGGAAAACCTGTGTTCAAGTTCCAACTTGCCAAATTTAAGGCACCTCTGGAAGCTGTTGCAGCCAAGATGGAAGTGAAGAAATGCGTGGATACGATGGCCTATGAGAAAAGAGTGCTAATTACAAAAACATTGGGAAAAATAGCAGAGAAATGTGATCGCTGAGATGTAAAAAGTTTTTAATGCTAGTTTCCACCATCTTTCAATGATACCCTGATCTTCACTGCAGAATGTAAAGGTTTCAACGTCTTGCTCTAATAAATCACTTGCCCTGAA

Publications

PMID - Link Title
22155607Update of the human secretoglobin (SCGB) gene superfamily and an example of 'evolutionary bloom' of androgen-binding protein genes within the mouse Scgb gene superfamily.