Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Gene Name COX7A2
Plot displaying the genomic locations of a parental gene (in chr6) and its retrocopy(ies). Each line represents a retrocopy.
Specie Homo sapiens
Full Name cytochrome c oxidase subunit 7A2
Also known as COX7AL|COX7AL1|COXVIIAL|COXVIIa-L|VIIAL
Coordinate chr6:75237675-75250298
Strand -
Gene summary Cytochrome c oxidase, the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of three catalytic subunits encoded by mitochondrial genes, and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, while the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes polypeptide 2 (liver isoform) of subunit VIIa, with this polypeptide being present in both muscle and non-muscle tissues. In addition to polypeptide 2, subunit VIIa includes polypeptide 1 (muscle isoform), which is present only in muscle tissues, and a related protein, which is present in all tissues. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 4 and 14. [provided by RefSeq, Oct 2009]

Retrocopy(s) from COX7A2

Retroname Coord Strand Genomic Region ENSG
COX7A2P1 chr14:67652314-67652618 - Intragenic
ENSG00000258626 UCSC
COX7A2P2 chr4:96902766-96903189 + Intergenic
ENSG00000236764 UCSC

Expression

Transcript Sequences

>NM_001366293.2
GGTTCCGGCGTGGCCATTTTCGTTGGTGGTGTTCAGTTGTGGCGGTTGCTGGTCAGTAACAGCCAAGATGCTGCGGAATCTGCTGGCTCTTCGTCAGATTGGGCAGAGGACGATAAGCACTGCTTCCCGCAGGCATTTTAAAAATAAAGTTCCGGAGAAGCAAAAACTGTTCCAGGAGGATGATGAAATTCCACTGTATCTAAAGGGTGGGGTAGCTGATGCCCTCCTGTATAGAGCCACCATGATTCTTACAGTTGGTGGAACAGCATATGCCATATATGAGCTGGCTGTGGCTTCATTTCCCAAGAAGCAGGAGTGACTTCAGTCATCCCAGCAATCGCTTGGTTCAGTTTCATTCAGCTCTCTATGGACCAGTAATCTGATAAATAACCGAGCTCTTCTTTGGGGATCAATATTTATTGACTTGTAGTAACTGCCACCAATAAAGCAGTCTTTACCATG