Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name COX7A2P2
Plot displaying the genomic locations of a retrocopy (in chr4) and its respective parental gene (in chr6). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr4:96902766-96903189  UCSC
Coordinates (T2T) chr4:100217571-100217994  UCSC
Coordinates (hg19) chr4:97823917-97824340  UCSC
Strand +
Parental Sequence NM_001366293.2
Parental seq. overlap 403 bp
Parental seq. overlap (%) 87.2%
Genomic Region Intergenic
Retrocopy Summary COX7A2P2, located on chr4:96902766-96903189, is a retrocopy of the parental gene COX7A2. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name COX7A2
Full Name cytochrome c oxidase subunit 7A2
Also known as COX7AL|COX7AL1|COXVIIAL|COXVIIa-L|VIIAL
Coordinate chr6:75237675-75250298
Strand -
Gene summary Cytochrome c oxidase, the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of three catalytic subunits encoded by mitochondrial genes, and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, while the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes polypeptide 2 (liver isoform) of subunit VIIa, with this polypeptide being present in both muscle and non-muscle tissues. In addition to polypeptide 2, subunit VIIa includes polypeptide 1 (muscle isoform), which is present only in muscle tissues, and a related protein, which is present in all tissues. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 4 and 14. [provided by RefSeq, Oct 2009]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes COX7A2P1
Bonobo Pan paniscus LOC100981677P1
Gorilla Gorilla gorilla LOC101148899P1
Orangutan Pongo abelii LOC100462105P1
Gibbon Nomascus leucogenys LOC100585631P2
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>COX7A2P2
aGTTGTGGCGGTTGCTGGTCAGTAACAGCCAAGATGCTGTGGAATCTGCTGGCTCTTCATCAGATTGGGCAGAGGACCATAAGCACTGCTTCCCACAGGCATTTTAAAAATAAAGTTCCAGAGAAACAAAAACTGTTCCAGGAGGATGATGGAATTCCACTGTATCTAAAGGGTGGGATAGCTGATGCCCTCCTTCATAGAGCCACCATGATTCTTACAGTTGGTGGAACAGCATATGCCATATATCAGCTGGCTGTGGCTTCATTTCCCAATAAAGGAGTGACTTCAATCATCCCAGCAATCACTTGGTTCACATTCATTCAGCTCTCTATGGACCAGAAATCTGATAAATGAGTTCTTCTTTGGGGATCAATATTTATTGACTTGTAGTAACTGCCGCCAATAAAGCAGTCTTTACCATG
>NM_001366293.2
GGTTCCGGCGTGGCCATTTTCGTTGGTGGTGTTCAGTTGTGGCGGTTGCTGGTCAGTAACAGCCAAGATGCTGCGGAATCTGCTGGCTCTTCGTCAGATTGGGCAGAGGACGATAAGCACTGCTTCCCGCAGGCATTTTAAAAATAAAGTTCCGGAGAAGCAAAAACTGTTCCAGGAGGATGATGAAATTCCACTGTATCTAAAGGGTGGGGTAGCTGATGCCCTCCTGTATAGAGCCACCATGATTCTTACAGTTGGTGGAACAGCATATGCCATATATGAGCTGGCTGTGGCTTCATTTCCCAAGAAGCAGGAGTGACTTCAGTCATCCCAGCAATCGCTTGGTTCAGTTTCATTCAGCTCTCTATGGACCAGTAATCTGATAAATAACCGAGCTCTTCTTTGGGGATCAATATTTATTGACTTGTAGTAACTGCCACCAATAAAGCAGTCTTTACCATG

Publications

PMID - Link Title