Retrocopy Name | COX7A2P2 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr4:96902766-96903189 UCSC | |
Coordinates (T2T) | chr4:100217571-100217994 UCSC | |
Coordinates (hg19) | chr4:97823917-97824340 UCSC | |
Strand | + | |
Parental Sequence | NM_001366293.2 | |
Parental seq. overlap | 403 bp | |
Parental seq. overlap (%) | 87.2% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | COX7A2P2, located on chr4:96902766-96903189, is a retrocopy of the parental gene COX7A2. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | COX7A2 |
Full Name | cytochrome c oxidase subunit 7A2 |
Also known as | COX7AL|COX7AL1|COXVIIAL|COXVIIa-L|VIIAL |
Coordinate | chr6:75237675-75250298 |
Strand | - |
Gene summary | Cytochrome c oxidase, the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of three catalytic subunits encoded by mitochondrial genes, and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, while the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes polypeptide 2 (liver isoform) of subunit VIIa, with this polypeptide being present in both muscle and non-muscle tissues. In addition to polypeptide 2, subunit VIIa includes polypeptide 1 (muscle isoform), which is present only in muscle tissues, and a related protein, which is present in all tissues. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 4 and 14. [provided by RefSeq, Oct 2009] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | COX7A2P1 |
![]() |
Bonobo | Pan paniscus | LOC100981677P1 |
![]() |
Gorilla | Gorilla gorilla | LOC101148899P1 |
![]() |
Orangutan | Pongo abelii | LOC100462105P1 |
![]() |
Gibbon | Nomascus leucogenys | LOC100585631P2 |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>COX7A2P2 |
aGTTGTGGCGGTTGCTGGTCAGTAACAGCCAAGATGCTGTGGAATCTGCTGGCTCTTCATCAGATTGGGCAGAGGACCATAAGCACTGCTTCCCACAGGCATTTTAAAAATAAAGTTCCAGAGAAACAAAAACTGTTCCAGGAGGATGATGGAATTCCACTGTATCTAAAGGGTGGGATAGCTGATGCCCTCCTTCATAGAGCCACCATGATTCTTACAGTTGGTGGAACAGCATATGCCATATATCAGCTGGCTGTGGCTTCATTTCCCAATAAAGGAGTGACTTCAATCATCCCAGCAATCACTTGGTTCACATTCATTCAGCTCTCTATGGACCAGAAATCTGATAAATGAGTTCTTCTTTGGGGATCAATATTTATTGACTTGTAGTAACTGCCGCCAATAAAGCAGTCTTTACCATG |
>NM_001366293.2 |
GGTTCCGGCGTGGCCATTTTCGTTGGTGGTGTTCAGTTGTGGCGGTTGCTGGTCAGTAACAGCCAAGATGCTGCGGAATCTGCTGGCTCTTCGTCAGATTGGGCAGAGGACGATAAGCACTGCTTCCCGCAGGCATTTTAAAAATAAAGTTCCGGAGAAGCAAAAACTGTTCCAGGAGGATGATGAAATTCCACTGTATCTAAAGGGTGGGGTAGCTGATGCCCTCCTGTATAGAGCCACCATGATTCTTACAGTTGGTGGAACAGCATATGCCATATATGAGCTGGCTGTGGCTTCATTTCCCAAGAAGCAGGAGTGACTTCAGTCATCCCAGCAATCGCTTGGTTCAGTTTCATTCAGCTCTCTATGGACCAGTAATCTGATAAATAACCGAGCTCTTCTTTGGGGATCAATATTTATTGACTTGTAGTAACTGCCACCAATAAAGCAGTCTTTACCATG |
PMID - Link | Title |
---|