Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Gene Name MRPL21
Plot displaying the genomic locations of a parental gene (in chr11) and its retrocopy(ies). Each line represents a retrocopy.
Specie Homo sapiens
Full Name mitochondrial ribosomal protein L21
Also known as L21mt|MRP-L21
Coordinate chr11:68891278-68903832
Strand -
Gene summary Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. Multiple transcript variants encoding different isoforms were identified through sequence analysis although some may be subject to nonsense-mediated decay (NMD). [provided by RefSeq, Jul 2008]

Retrocopy(s) from MRPL21

Retroname Coord Strand Genomic Region ENSG
MRPL21P1 chr12:68143353-68143748 + Intergenic
ENSG00000256708 UCSC

Expression

Transcript Sequences

>NM_181514.2
GTTTCCGGCCGAGGCTGCGGCCATGGCAGCATCTTCCCTGACGGTCACCTTAGGGCGGCTGGCGTCCGCGTGCAGCCACAGCATCCTGAGACCTTCGGGGCCCGGAGCAGCCTCCCTTTGGTCTGCTTCTCGAAGGTTCAATTCACAGAGCACTTCATATCTACCAGGATATGTTCCTAAAACATCCCTGAGTTCACCACCTTGGCCAGAAGTTGTTCTGCCAGACCCAGTTGAGGAGACCAGACACCATGCAGAGGTCGTGAAGAAGGTGAATGAGATGATCGTCACGGGGCAGTATGGCAGGCTCTTTGCCGTGGTGCACTTTGCCAGCCGCCAGTGGAAGGTGACCTCTGAAGACCTGATCTTAATTGGAAATGAACTAGACCTTGCGTGTGGAGAGAGAATTCGACTGGAGAAGGTCCTGCTGGTTGGGGCAGACAACTTCACGCTGCTTGGCAAGCCACTCCTCGGAAAGGATCTTGTTCGAGTAGAAGCCACAGTCATTGAAAAGACAGAATCATGGCCAAGAATCATTATGAGATTCAGGAAAAGGAAAAACTTCAAGAAGAAAAGAATCGTCACGACCCCGCAGACTGTCCTCCGGATAAACAGCATTGAGATTGCTCCGTGTTTGTTGTGATTACCGAGTTAATACTTACAAAAGGATAAAAATAAACTCCTGCTTCCCAAGGA