Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Gene Name Ins2
Plot displaying the genomic locations of a parental gene (in chr1) and its retrocopy(ies). Each line represents a retrocopy.
Specie Rattus norvegicus
Full Name insulin 2
Also known as CP-II
Coordinate chr1:215856967-215858034
Strand -
Gene summary Predicted to enable several functions, including identical protein binding activity; signaling receptor binding activity; and zinc ion binding activity. Predicted to be involved in several processes, including negative regulation of catabolic process; positive regulation of macromolecule metabolic process; and positive regulation of signal transduction. Predicted to act upstream of or within several processes, including cell surface receptor signaling pathway; intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress; and positive regulation of phosphorylation. Located in extracellular space. Colocalizes with secretory granule. Used to study hypertension. Biomarker of Alzheimer's disease. Human ortholog(s) of this gene implicated in diabetic retinopathy; glucose metabolism disease (multiple); insulinoma; and pancreatic cancer. Orthologous to human INS (insulin). [provided by Alliance of Genome Resources, Apr 2022]

Retrocopy(s) from Ins2

Retroname Coord Strand Genomic Region ENSG
Ins2P1 chr1:272799942-272800346 + Intergenic
N/A UCSC

Expression

Transcript Sequences

>NM_019130.2
AGCCCTAAGTGACCAGCTACAGTCGGAAACCATCAGCAAGCAGGTCATTGTTCCAACATGGCCCTGTGGATCCGCTTCCTGCCCCTGCTGGCCCTGCTCATCCTCTGGGAGCCCCGCCCTGCCCAGGCTTTTGTCAAACAGCACCTTTGTGGTTCTCACTTGGTGGAAGCTCTCTACCTGGTGTGTGGGGAGCGTGGATTCTTCTACACACCCATGTCCCGCCGCGAAGTGGAGGACCCACAAGTGGCACAACTGGAGCTGGGTGGAGGCCCGGGGGCAGGTGACCTTCAGACCTTGGCACTGGAGGTGGCCCGGCAGAAGCGCGGCATCGTGGATCAGTGCTGCACCAGCATCTGCTCTCTCTACCAACTGGAGAACTACTGCAACTAGGCCCACCACTACCCTGTCCACCCCTCTGCAATGAATAAAACCTTTGAAAGAGCACTACAA