RCPedia: Rtcs

Summary

Retrocopy Name	Ins2P1	Plot displaying the genomic locations of a retrocopy (in chr1) and its respective parental gene (in chr1). Each line represents a retrocopy.
Species	Rattus norvegicus
Coordinates	chr1:272799942-272800346 UCSC
Strand	+
Parental Sequence	NM_019130.2
Parental seq. overlap	373 bp
Parental seq. overlap (%)	82.9%
Genomic Region	Intergenic
Retrocopy Summary	Ins2P1, located on chr1:272799942-272800346, is a retrocopy of the parental gene Ins2. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name	Ins2
Full Name	insulin 2
Also known as	CP-II
Coordinate	chr1:215856967-215858034
Strand	-
Gene summary	Predicted to enable several functions, including identical protein binding activity; signaling receptor binding activity; and zinc ion binding activity. Predicted to be involved in several processes, including negative regulation of catabolic process; positive regulation of macromolecule metabolic process; and positive regulation of signal transduction. Predicted to act upstream of or within several processes, including cell surface receptor signaling pathway; intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress; and positive regulation of phosphorylation. Located in extracellular space. Colocalizes with secretory granule. Used to study hypertension. Biomarker of Alzheimer's disease. Human ortholog(s) of this gene implicated in diabetic retinopathy; glucose metabolism disease (multiple); insulinoma; and pancreatic cancer. Orthologous to human INS (insulin). [provided by Alliance of Genome Resources, Apr 2022]

Homology

Species	Scientific Name	Retrocopy
Mouse	Mus musculus	Ins2P1
Human	Homo sapiens	Without Homology
Chimpanzee	Pan troglodytes	Without Homology
Bonobo	Pan paniscus	Without Homology
Gorilla	Gorilla gorilla	Without Homology
Orangutan	Pongo abelii	Without Homology
Gibbon	Nomascus leucogenys	Without Homology
Green monkey	Chlorocebus sabaeus	Without Homology
Crab-eating macaque	Macaca fascicularis	Without Homology
Rhesus	Macaca mulatta	Without Homology
Baboon	Papio anubis	Without Homology
Golden snub-nosed monkey	Rhinopithecus roxellana	Without Homology
Marmoset	Callithrix jacchus	Without Homology
Mouse lemur	Microcebus murinus	Without Homology
Chinese hamster	Cricetulus griseus	Without Homology
Rabbit	Oryctolagus cuniculus	Without Homology
Pig	Sus scrofa	Without Homology
Cow	Bos taurus	Without Homology
Sheep	Ovis aries	Without Homology
Dolphin	Tursiops truncatus	Without Homology
Horse	Equus caballus	Without Homology
Dog	Canis familiaris	Without Homology
Panda	Ailuropoda melanoleuca	Without Homology
Cat	Felis catus	Without Homology
Pale spear-nosed bat	Phyllostomus discolor	Without Homology
Velvety free-tailed bat	Molossus molossus	Without Homology
Greater mouse-eared bat	Myotis myotis	Without Homology
Kuhl's pipistrelle	Pipistrellus kuhlii	Without Homology
Greater horseshoe bat	Rhinolophus ferrumequinum	Without Homology
Egyptian rousette	Rousettus aegyptiacus	Without Homology
Sloth	Choloepus didactylus	Without Homology
Tasmanian Devil	Sarcophilus harrisii	Without Homology
Opossum	Monodelphis domestica	Without Homology
Platypus	Ornithorhynchus anatinus	Without Homology
Chicken	Gallus gallus	Without Homology
Turkey	Meleagris gallopavo	Without Homology
Zebra Finch	Taeniopygia guttata	Without Homology
Budgerigar	Melopsittacus undulatus	Without Homology
Painted Turtle	Chrysemys picta	Without Homology
Lizard	Anolis Carolinensis	Without Homology
Frog	Xenopus tropicalis	Without Homology
Zebrafish	Danio rerio	Without Homology
Drosophila	Drosophila melanogaster	Without Homology

Expression

Related Sequence

>Ins2P1
CCAGGTCATTGTTCCAACATGGCCCTGTGGATGCGCTTCCTGCCCCTGCTGGCCCTGCTCGTCCTCTGGGAGCCCAAGCCTGCCCAGGCTTTTGTCAAACAGCACCTTTGTGGTCCTCACCTGGTGGAGGCTCTGTACCTGGTGTGTGGGGAACGTGGTTTCTTCTACACACCCAAGTCCCGTCGTGAAGTGGAGGACCCGCAAGTGCCACAACTGGAGCTGGGTGGAGGCCCGGAGGCCGGGGATCTTCAGACCTTGGCACTGGAGGTTGCCCGGCAGAAGCGTGGCATTGTGGATCAGTGCTGCACCAGCATCTGCTCCCTCTACCAACTGGAGAACTACTGCAACTGAGTCCACCACTCCCCGCCCACCCCTCTGCAATGAATAAAGCCTTTGAATGAGCAC

>NM_019130.2
AGCCCTAAGTGACCAGCTACAGTCGGAAACCATCAGCAAGCAGGTCATTGTTCCAACATGGCCCTGTGGATCCGCTTCCTGCCCCTGCTGGCCCTGCTCATCCTCTGGGAGCCCCGCCCTGCCCAGGCTTTTGTCAAACAGCACCTTTGTGGTTCTCACTTGGTGGAAGCTCTCTACCTGGTGTGTGGGGAGCGTGGATTCTTCTACACACCCATGTCCCGCCGCGAAGTGGAGGACCCACAAGTGGCACAACTGGAGCTGGGTGGAGGCCCGGGGGCAGGTGACCTTCAGACCTTGGCACTGGAGGTGGCCCGGCAGAAGCGCGGCATCGTGGATCAGTGCTGCACCAGCATCTGCTCTCTCTACCAACTGGAGAACTACTGCAACTAGGCCCACCACTACCCTGTCCACCCCTCTGCAATGAATAAAACCTTTGAAAGAGCACTACAA

>NM_019130.2 

AGCCCTAAGTGACCAGCTACAGTCGGAAACCATCAGCAAGCAGGTCATTGTTCCAACATGGCCCTGTGGATCCGCTTCCTGCCCCTGCTGGCCCTGCTCATCCTCTGGGAGCCCCGCCCTGCCCAGGCTTTTGTCAAACAGCACCTTTGTGGTTCTCACTTGGTGGAAGCTCTCTACCTGGTGTGTGGGGAGCGTGGATTCTTCTACACACCCATGTCCCGCCGCGAAGTGGAGGACCCACAAGTGGCACAACTGGAGCTGGGTGGAGGCCCGGGGGCAGGTGACCTTCAGACCTTGGCACTGGAGGTGGCCCGGCAGAAGCGCGGCATCGTGGATCAGTGCTGCACCAGCATCTGCTCTCTCTACCAACTGGAGAACTACTGCAACTAGGCCCACCACTACCCTGTCCACCCCTCTGCAATGAATAAAACCTTTGAAAGAGCACTACAA

Publications

PMID - Link	Title