Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Gene Name rpl38
Plot displaying the genomic locations of a parental gene (in chr12) and its retrocopy(ies). Each line represents a retrocopy.
Specie Danio rerio
Full Name ribosomal protein L38
Also known as si:dkey-1f1.2|wu:fb06b10|zgc:92860
Coordinate chr12:38556491-38561296
Strand +
Gene summary Predicted to be a structural constituent of ribosome. Acts upstream of or within chordate embryonic development. Predicted to be located in ribosome. Predicted to be part of cytosolic large ribosomal subunit. Orthologous to human RPL38 (ribosomal protein L38). [provided by Alliance of Genome Resources, Apr 2022]

Retrocopy(s) from rpl38

Retroname Coord Strand Genomic Region ENSG
rpl38P1 chr16:49249717-49249890 + Intergenic
N/A UCSC

Expression

Transcript Sequences

>NM_001002486.2
TTTTCCCCCCTCGCTCGCGGGACGTGGTCGAGTCGAAACTGAAACACAATGCCACGTAAAATCGAAGAAATCAAAGATTTCCTGCTTACAGCAAGGAGGAAGGATGCCAAGTCTGTCAAGATCAAGAAGAACAAGGACAATGTGAAGTTCAAGGTGCGCTGCAGCAGATACCTGTACACATTGGTCATCACAGACAAAGAGAAGGCTGAGAAGCTCAAGCAGTCCCTGCCACCAGGTTTGGCTGTGAAGGAGCTGAAGTAGATGTCTCTTGTACAAATGTTGGAATAAAATTGGATAAAATTAA