Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Gene Name MT2A
Plot displaying the genomic locations of a parental gene (in chr16) and its retrocopy(ies). Each line represents a retrocopy.
Specie Homo sapiens
Full Name metallothionein 2A
Also known as MT-2|MT-II|MT2
Coordinate chr16:56608584-56609497
Strand +
Gene summary This gene is a member of the metallothionein family of genes. Proteins encoded by this gene family are low in molecular weight, are cysteine-rich, lack aromatic residues, and bind divalent heavy metal ions, altering the intracellular concentration of heavy metals in the cell. These proteins act as anti-oxidants, protect against hydroxyl free radicals, are important in homeostatic control of metal in the cell, and play a role in detoxification of heavy metals. The encoded protein interacts with the protein encoded by the homeobox containing 1 gene in some cell types, controlling intracellular zinc levels, affecting apoptotic and autophagy pathways. Some polymorphisms in this gene are associated with an increased risk of cancer. [provided by RefSeq, Sep 2017]

Retrocopy(s) from MT2A

Retroname Coord Strand Genomic Region ENSG
MT2P1 chr4:68376250-68376650 + Intergenic
ENSG00000162840 UCSC

Expression

Transcript Sequences

>NM_005953.5
ACCACGCCTCCTCCAAGTCCCAGCGAACCCGCGTGCAACCTGTCCCGACTCTAGCCGCCTCTTCAGCTCGCCATGGATCCCAACTGCTCCTGCGCCGCCGGTGACTCCTGCACCTGCGCCGGCTCCTGCAAATGCAAAGAGTGCAAATGCACCTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCTGTGGGCTGTGCCAAGTGTGCCCAGGGCTGCATCTGCAAAGGGGCGTCGGACAAGTGCAGCTGCTGCGCCTGATGCTGGGACAGCCCCGCTCCCAGATGTAAAGAACGCGACTTCCACAAACCTGGATTTTTTATGTACAACCCTGACCGTGACCGTTTGCTATATTCCTTTTTCTATGAAATAATGTGAATGATAATAAAACAGCTTTGACTTGA