Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name MT2P1
Wait
Plot displaying the genomic locations of a retrocopy (in chr4) and its respective parental gene (in chr16). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr4:68376250-68376650  UCSC
Coordinates (T2T) chr4:71817325-71817725  UCSC
Coordinates (hg19) chr4:69241968-69242368  UCSC
Strand +
Parental Sequence NM_005953.5
Parental seq. overlap 384 bp
Parental seq. overlap (%) 95.5%
Genomic Region Intergenic
Retrocopy Summary MT2P1, located on chr4:68376250-68376650, is a retrocopy of the parental gene MT2A. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name MT2A
Full Name metallothionein 2A
Also known as MT-2|MT-II|MT2
Coordinate chr16:56608584-56609497
Strand +
Gene summary This gene is a member of the metallothionein family of genes. Proteins encoded by this gene family are low in molecular weight, are cysteine-rich, lack aromatic residues, and bind divalent heavy metal ions, altering the intracellular concentration of heavy metals in the cell. These proteins act as anti-oxidants, protect against hydroxyl free radicals, are important in homeostatic control of metal in the cell, and play a role in detoxification of heavy metals. The encoded protein interacts with the protein encoded by the homeobox containing 1 gene in some cell types, controlling intracellular zinc levels, affecting apoptotic and autophagy pathways. Some polymorphisms in this gene are associated with an increased risk of cancer. [provided by RefSeq, Sep 2017]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes MT2AP1
Bonobo Pan paniscus LOC100986475P1
Gorilla Gorilla gorilla LOC101124572P1
Orangutan Pongo abelii MT2AP1
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Massive Mining of Publicly Available RNA-seq Data from Human and Mouse - (ARCHS4)

Related Sequence

>MT2P1
GACCACGCCTCCTCCAAGTCCCAGCGAGCCCGTGTACAACCTGTCCCGACTCCAGCCGCCTCTTCAGCTCGCCATGGATCCCAACTGCTCCTGTGCCGCCAGTGACTCCTGCACCTGCGCCGGCTCCTGCAAGTGCAAAGAGTGCAAATGCACCTCCTGCAAGAAAAGCTGCTGCTCCTGCTGTCCTGTGGGCTGTGCCAAGTGTGCCCAGGGCTGCATCTGCAAAGGGGCGTCGGACAAGTGCAGCTGCTGTGCCTGATGCTGGGACAGCCCTGCCCCCAGATGTAAATAACGCGACCTCTACAAACCTGGATTTTTTATGTACAACCCTGACCCTGACGTTTGCTACATTCCTTTTTCTATGAAATAATGTGAATGATAATAAAACAGCTTTGACTTGA
>NM_005953.5
ACCACGCCTCCTCCAAGTCCCAGCGAACCCGCGTGCAACCTGTCCCGACTCTAGCCGCCTCTTCAGCTCGCCATGGATCCCAACTGCTCCTGCGCCGCCGGTGACTCCTGCACCTGCGCCGGCTCCTGCAAATGCAAAGAGTGCAAATGCACCTCCTGCAAGAAAAGCTGCTGCTCCTGCTGCCCTGTGGGCTGTGCCAAGTGTGCCCAGGGCTGCATCTGCAAAGGGGCGTCGGACAAGTGCAGCTGCTGCGCCTGATGCTGGGACAGCCCCGCTCCCAGATGTAAAGAACGCGACTTCCACAAACCTGGATTTTTTATGTACAACCCTGACCGTGACCGTTTGCTATATTCCTTTTTCTATGAAATAATGTGAATGATAATAAAACAGCTTTGACTTGA

Publications

PMID - Link Title
No publications available for this retrocopy