Summary

Gene Name	NDUFA1
Specie	Homo sapiens
Full Name	NADH:ubiquinone oxidoreductase subunit A1
Also known as	CI-MWFE|MC1DN12|MWFE|ZNF183
Coordinate	chrX:119871832-119876662
Strand	+
Gene summary	The human NDUFA1 gene codes for an essential component of complex I of the respiratory chain, which transfers electrons from NADH to ubiquinone. It has been noted that the N-terminal hydrophobic domain has the potential to be folded into an alpha-helix spanning the inner mitochondrial membrane with a C-terminal hydrophilic domain interacting with globular subunits of complex I. The highly conserved two-domain structure suggests that this feature is critical for the protein function and might act as an anchor for the NADH:ubiquinone oxidoreductase complex at the inner mitochondrial membrane. However, the NDUFA1 peptide is one of about 31 components of the "hydrophobic protein" (HP) fraction of complex I which is involved in proton translocation. Thus the NDUFA1 peptide may also participate in that function. [provided by RefSeq, Jul 2008]

Retrocopy(s) from NDUFA1

Retroname	Coord	Strand	Genomic Region	ENSG
NDUFA1P1	chr2:86454434-86454608	+	Intragenic	N/A	UCSC
NDUFA1P2	chr9:126454695-126454861	-	Intragenic	N/A	UCSC

Expression

Transcript Sequences

>NM_004541.4

GCTTGCTGGGAAGAGAGGCGAAGCCAGGTCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTCTCCCCGGACTCTCCGTCATGGGCGTGTGCTTGTTGATTCCAGGACTGGCTACTGCGTACATCCACAGGTTCACTAACGGGGGCAAGGAAAAAAGGGTTGCTCATTTTGGGTATCACTGGAGTCTGATGGAAAGAGATAGGCGCATCTCTGGAGTTGATCGTTACTATGTGTCAAAGGGTTTGGAGAACATTGATTAAGGAAGCATTTTCCTGATTGATGAAAAAAATAACTCAGTTATGGCCATCTACCCCTGCTAGAAGGTTACAGTGTATTATGTAGCATGCAATGTGTTATGTAGTGCTTAATAAAAATAAAATGAAAAAAA