Retrocopy Name | NDUFA1P2 |
![]() |
Species | Homo sapiens | |
Coordinates (hg38) | chr9:126454695-126454861 UCSC | |
Coordinates (T2T) | chr9:138660464-138660630 UCSC | |
Coordinates (hg19) | chr9:129216974-129217140 UCSC | |
Strand | - | |
Parental Sequence | NM_004541.4 | |
Parental seq. overlap | 138 bp | |
Parental seq. overlap (%) | 32.3% | |
Genomic Region |
Intragenic (MVB12B) |
|
Retrocopy Summary | NDUFA1P2, located on chr9:126454695-126454861, is a retrocopy of the parental gene NDUFA1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | NDUFA1 |
Full Name | NADH:ubiquinone oxidoreductase subunit A1 |
Also known as | CI-MWFE|MC1DN12|MWFE|ZNF183 |
Coordinate | chrX:119871832-119876662 |
Strand | + |
Gene summary | The human NDUFA1 gene codes for an essential component of complex I of the respiratory chain, which transfers electrons from NADH to ubiquinone. It has been noted that the N-terminal hydrophobic domain has the potential to be folded into an alpha-helix spanning the inner mitochondrial membrane with a C-terminal hydrophilic domain interacting with globular subunits of complex I. The highly conserved two-domain structure suggests that this feature is critical for the protein function and might act as an anchor for the NADH:ubiquinone oxidoreductase complex at the inner mitochondrial membrane. However, the NDUFA1 peptide is one of about 31 components of the "hydrophobic protein" (HP) fraction of complex I which is involved in proton translocation. Thus the NDUFA1 peptide may also participate in that function. [provided by RefSeq, Jul 2008] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | NDUFA1P2 |
![]() |
Bonobo | Pan paniscus | NDUFA1P2 |
![]() |
Gorilla | Gorilla gorilla | NDUFA1P2 |
![]() |
Orangutan | Pongo abelii | NDUFA1P2 |
![]() |
Gibbon | Nomascus leucogenys | NDUFA1P1 |
![]() |
Green monkey | Chlorocebus sabaeus | Without Homology |
![]() |
Crab-eating macaque | Macaca fascicularis | Without Homology |
![]() |
Rhesus | Macaca mulatta | Without Homology |
![]() |
Baboon | Papio anubis | Without Homology |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>NDUFA1P2 |
GTTACCATGTGTCAAAGCATTTAAAGAACATTGATTAAGGAAGCATTTTCCTGGCTGGTTAAAAAAAAAAAAACTCAATTATGGTCATCGACCCCTACCAGAAGGCTATTCACTGTATTACGTGGCATGCACATTATGCAGTGCTTAACAAAAGTAAAATGAAAAAG |
>NM_004541.4 |
GCTTGCTGGGAAGAGAGGCGAAGCCAGGTCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTCTCCCCGGACTCTCCGTCATGGGCGTGTGCTTGTTGATTCCAGGACTGGCTACTGCGTACATCCACAGGTTCACTAACGGGGGCAAGGAAAAAAGGGTTGCTCATTTTGGGTATCACTGGAGTCTGATGGAAAGAGATAGGCGCATCTCTGGAGTTGATCGTTACTATGTGTCAAAGGGTTTGGAGAACATTGATTAAGGAAGCATTTTCCTGATTGATGAAAAAAATAACTCAGTTATGGCCATCTACCCCTGCTAGAAGGTTACAGTGTATTATGTAGCATGCAATGTGTTATGTAGTGCTTAATAAAAATAAAATGAAAAAAA |
PMID - Link | Title |
---|---|
No publications available for this retrocopy |