Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name NDUFA1P2
Wait
Plot displaying the genomic locations of a retrocopy (in chr9) and its respective parental gene (in chrX). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr9:126454695-126454861  UCSC
Coordinates (T2T) chr9:138660464-138660630  UCSC
Coordinates (hg19) chr9:129216974-129217140  UCSC
Strand -
Parental Sequence NM_004541.4
Parental seq. overlap 138 bp
Parental seq. overlap (%) 32.3%
Genomic Region Intragenic (MVB12B)
Retrocopy Summary NDUFA1P2, located on chr9:126454695-126454861, is a retrocopy of the parental gene NDUFA1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name NDUFA1
Full Name NADH:ubiquinone oxidoreductase subunit A1
Also known as CI-MWFE|MC1DN12|MWFE|ZNF183
Coordinate chrX:119871832-119876662
Strand +
Gene summary The human NDUFA1 gene codes for an essential component of complex I of the respiratory chain, which transfers electrons from NADH to ubiquinone. It has been noted that the N-terminal hydrophobic domain has the potential to be folded into an alpha-helix spanning the inner mitochondrial membrane with a C-terminal hydrophilic domain interacting with globular subunits of complex I. The highly conserved two-domain structure suggests that this feature is critical for the protein function and might act as an anchor for the NADH:ubiquinone oxidoreductase complex at the inner mitochondrial membrane. However, the NDUFA1 peptide is one of about 31 components of the "hydrophobic protein" (HP) fraction of complex I which is involved in proton translocation. Thus the NDUFA1 peptide may also participate in that function. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes NDUFA1P2
Bonobo Pan paniscus NDUFA1P2
Gorilla Gorilla gorilla NDUFA1P2
Orangutan Pongo abelii NDUFA1P2
Gibbon Nomascus leucogenys NDUFA1P1
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

This retrocopy transcript is not present in the ARCHS4 database for expression quantificationThis retrocopy transcript is not present in the GTEx database for expression quantification.

Related Sequence

>NDUFA1P2
GTTACCATGTGTCAAAGCATTTAAAGAACATTGATTAAGGAAGCATTTTCCTGGCTGGTTAAAAAAAAAAAAACTCAATTATGGTCATCGACCCCTACCAGAAGGCTATTCACTGTATTACGTGGCATGCACATTATGCAGTGCTTAACAAAAGTAAAATGAAAAAG
>NM_004541.4
GCTTGCTGGGAAGAGAGGCGAAGCCAGGTCACCTTTCAAGGACCCAGAAGTAGGGTTTTGGCCTAGGTAACGGGGCAGAGATGTGGTTCGAGATTCTCCCCGGACTCTCCGTCATGGGCGTGTGCTTGTTGATTCCAGGACTGGCTACTGCGTACATCCACAGGTTCACTAACGGGGGCAAGGAAAAAAGGGTTGCTCATTTTGGGTATCACTGGAGTCTGATGGAAAGAGATAGGCGCATCTCTGGAGTTGATCGTTACTATGTGTCAAAGGGTTTGGAGAACATTGATTAAGGAAGCATTTTCCTGATTGATGAAAAAAATAACTCAGTTATGGCCATCTACCCCTGCTAGAAGGTTACAGTGTATTATGTAGCATGCAATGTGTTATGTAGTGCTTAATAAAAATAAAATGAAAAAAA

Publications

PMID - Link Title
No publications available for this retrocopy