Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Gene Name NDUFB2
Plot displaying the genomic locations of a parental gene (in chr7) and its retrocopy(ies). Each line represents a retrocopy.
Specie Homo sapiens
Full Name NADH:ubiquinone oxidoreductase subunit B2
Also known as AGGG|CI-AGGG
Coordinate chr7:140696708-140706643
Strand +
Gene summary The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is composed of 45 different subunits. This protein has NADH dehydrogenase activity and oxidoreductase activity. It plays a important role in transfering electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Hydropathy analysis revealed that this subunit and 4 other subunits have an overall hydrophilic pattern, even though they are found within the hydrophobic protein (HP) fraction of complex I. [provided by RefSeq, Jul 2008]

Retrocopy(s) from NDUFB2

Retroname Coord Strand Genomic Region ENSG
NDUFB2P1 chr4:154724759-154724948 + Intergenic
 ENSG00000249074 UCSC

Expression

Transcript Sequences

>NM_004546.3
GAGGCGGCTGGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTGACTCGGCTGGCGTCTTTCGCTCGCGTTGGAGGCCGCCTTTTCAGAAGCGGCTGCGCACGGACTGCTGGAGATGGTGGAGTCCGTCATGCCGGTGGTGGTGTGCACATTGAGCCCCGGTATAGACAGTTCCCCCAGCTGACCAGATCCCAGGTGTTCCAGAGCGAGTTCTTCAGCGGACTCATGTGGTTCTGGATTCTCTGGCGCTTTTGGCATGACTCAGAAGAGGTGCTGGGTCACTTTCCGTATCCTGATCCTTCCCAGTGGACAGATGAAGAATTAGGTATCCCTCCTGATGATGAAGACTGAAGGTGTAGACTCAGCCTCACTCTGTACAAGAGCCAGGTGAGAATTTCAAGGATTATCGACTTCATATTGCACATTAAAGTTACAAATTAAAGTGGCTTGGTCAAGAATGA