Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name NDUFB2P1
Plot displaying the genomic locations of a retrocopy (in chr4) and its respective parental gene (in chr7). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr4:154724759-154724948  UCSC
Coordinates (T2T) chr4:158056566-158056755  UCSC
Coordinates (hg19) chr4:155645911-155646100  UCSC
Strand +
Parental Sequence NM_004546.3
Parental seq. overlap 167 bp
Parental seq. overlap (%) 35.7%
Genomic Region Intergenic
Retrocopy Summary NDUFB2P1, located on chr4:154724759-154724948, is a retrocopy of the parental gene NDUFB2. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name NDUFB2
Full Name NADH:ubiquinone oxidoreductase subunit B2
Also known as AGGG|CI-AGGG
Coordinate chr7:140696708-140706643
Strand +
Gene summary The protein encoded by this gene is a subunit of the multisubunit NADH:ubiquinone oxidoreductase (complex I). Mammalian complex I is composed of 45 different subunits. This protein has NADH dehydrogenase activity and oxidoreductase activity. It plays a important role in transfering electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Hydropathy analysis revealed that this subunit and 4 other subunits have an overall hydrophilic pattern, even though they are found within the hydrophobic protein (HP) fraction of complex I. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes NDUFB2P1
Bonobo Pan paniscus NDUFB2P1
Gorilla Gorilla gorilla NDUFB2P1
Orangutan Pongo abelii NDUFB2P1
Gibbon Nomascus leucogenys NDUFB2P1
Green monkey Chlorocebus sabaeus NDUFB2P1
Crab-eating macaque Macaca fascicularis NDUFB2P1
Rhesus Macaca mulatta NDUFB2P1
Baboon Papio anubis NDUFB2P1
Golden snub-nosed monkey Rhinopithecus roxellana NDUFB2P1
Marmoset Callithrix jacchus NDUFB2P1
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>NDUFB2P1
ATGGTTCTGGATTCTCTGGTGCTTTTGTCATGAGACTCAGATGCTGTGCTGGGTCACTTTCTATATCCAGAGTCTTCCCAGTGGACAGATGTAGAATTAGGCATCCTTCCTAATGATGAAGACTGAAAGTGTAGACTCAGCCTTTACAAGAGCCAGGTGAGCATTTCAAGAGATTGTAGACTTCATATTG
>NM_004546.3
GAGGCGGCTGGGGACCGCGGGGCGGACGGGAGCGAGTATGTCCGCTCTGACTCGGCTGGCGTCTTTCGCTCGCGTTGGAGGCCGCCTTTTCAGAAGCGGCTGCGCACGGACTGCTGGAGATGGTGGAGTCCGTCATGCCGGTGGTGGTGTGCACATTGAGCCCCGGTATAGACAGTTCCCCCAGCTGACCAGATCCCAGGTGTTCCAGAGCGAGTTCTTCAGCGGACTCATGTGGTTCTGGATTCTCTGGCGCTTTTGGCATGACTCAGAAGAGGTGCTGGGTCACTTTCCGTATCCTGATCCTTCCCAGTGGACAGATGAAGAATTAGGTATCCCTCCTGATGATGAAGACTGAAGGTGTAGACTCAGCCTCACTCTGTACAAGAGCCAGGTGAGAATTTCAAGGATTATCGACTTCATATTGCACATTAAAGTTACAAATTAAAGTGGCTTGGTCAAGAATGA

Publications

PMID - Link Title