Gene Name | NDUFS6 |
|
Specie | Homo sapiens | |
Full Name | NADH:ubiquinone oxidoreductase subunit S6 | |
Also known as | CI-13kA|CI-13kD-A|CI13KDA|MC1DN9 | |
Coordinate | chr5:1801407-1816048 | |
Strand | + | |
Gene summary | This gene encodes a subunit of the NADH:ubiquinone oxidoreductase (complex I), which is the first enzyme complex in the electron transport chain of mitochondria. This complex functions in the transfer of electrons from NADH to the respiratory chain. The subunit encoded by this gene is one of seven subunits in the iron-sulfur protein fraction. Mutations in this gene cause mitochondrial complex I deficiency, a disease that causes a wide variety of clinical disorders, including neonatal disease and adult-onset neurodegenerative disorders.[provided by RefSeq, Oct 2009] |
Retroname | Coord | Strand | Genomic Region | ENSG | |
---|---|---|---|---|---|
NDUFS6P1 | chr3:135959416-135959568 | - |
Intergenic |
ENSG00000241905 | UCSC |
>NM_004553.6 |
AGCGGCGCAAAATGGCGGCGGCGATGACCTTCTGCCGGCTGCTGAACCGGTGTGGCGAGGCGGCGCGGAGCCTGCCCCTGGGCGCCAGGTGTTTCGGGGTGCGGGTCTCGCCGACCGGGGAGAAGGTCACGCACACTGGCCAGGTTTATGATGATAAAGACTACAGGAGAATTCGGTTTGTAGGTCGTCAGAAAGAGGTGAATGAAAACTTTGCCATTGATTTGATAGCAGAGCAGCCCGTGAGCGAGGTGGAGACTCGGGTGATAGCGTGCGATGGCGGCGGGGGAGCTCTTGGCCACCCAAAAGTGTATATAAACTTGGACAAAGAAACAAAAACCGGCACATGCGGTTACTGTGGGCTCCAGTTCAGACAGCACCACCACTAGAGCGTGTGGCACGCCGGGGGTCCCGCAGCATCCTGTGAGCATTTCCGCGGGGAAGCTGAGCACGTGAAGCTCGCTGGTTCTGTGCGAAGGGTATTCCTGGTGCTGAATAAAGGGTGTTGCTGTCAAGGCTGA |