Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name NDUFS6P1
Plot displaying the genomic locations of a retrocopy (in chr3) and its respective parental gene (in chr5). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr3:135959416-135959568  UCSC
Coordinates (T2T) chr3:138705191-138705343  UCSC
Coordinates (hg19) chr3:135678258-135678410  UCSC
Strand -
Parental Sequence NM_004553.6
Parental seq. overlap 127 bp
Parental seq. overlap (%) 24.5%
Genomic Region Intergenic
Retrocopy Summary NDUFS6P1, located on chr3:135959416-135959568, is a retrocopy of the parental gene NDUFS6. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name NDUFS6
Full Name NADH:ubiquinone oxidoreductase subunit S6
Also known as CI-13kA|CI-13kD-A|CI13KDA|MC1DN9
Coordinate chr5:1801407-1816048
Strand +
Gene summary This gene encodes a subunit of the NADH:ubiquinone oxidoreductase (complex I), which is the first enzyme complex in the electron transport chain of mitochondria. This complex functions in the transfer of electrons from NADH to the respiratory chain. The subunit encoded by this gene is one of seven subunits in the iron-sulfur protein fraction. Mutations in this gene cause mitochondrial complex I deficiency, a disease that causes a wide variety of clinical disorders, including neonatal disease and adult-onset neurodegenerative disorders.[provided by RefSeq, Oct 2009]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes NDUFS6P1
Bonobo Pan paniscus NDUFS6P1
Gorilla Gorilla gorilla NDUFS6P1
Orangutan Pongo abelii Without Homology
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>NDUFS6P1
GCCAGGTGTTTTGGGGTATGGGCCTTGCCAACTGGAGAGAAGGTCATGCATGCCAGCCAGGTTGATGATAATAAAGACTCCAGAAAAATTCAGTTTGTGGGTTGTCAGAAAGAGGTGAATGTAAACTTTGCCACTGATTTGATGACAGAGCAA
>NM_004553.6
AGCGGCGCAAAATGGCGGCGGCGATGACCTTCTGCCGGCTGCTGAACCGGTGTGGCGAGGCGGCGCGGAGCCTGCCCCTGGGCGCCAGGTGTTTCGGGGTGCGGGTCTCGCCGACCGGGGAGAAGGTCACGCACACTGGCCAGGTTTATGATGATAAAGACTACAGGAGAATTCGGTTTGTAGGTCGTCAGAAAGAGGTGAATGAAAACTTTGCCATTGATTTGATAGCAGAGCAGCCCGTGAGCGAGGTGGAGACTCGGGTGATAGCGTGCGATGGCGGCGGGGGAGCTCTTGGCCACCCAAAAGTGTATATAAACTTGGACAAAGAAACAAAAACCGGCACATGCGGTTACTGTGGGCTCCAGTTCAGACAGCACCACCACTAGAGCGTGTGGCACGCCGGGGGTCCCGCAGCATCCTGTGAGCATTTCCGCGGGGAAGCTGAGCACGTGAAGCTCGCTGGTTCTGTGCGAAGGGTATTCCTGGTGCTGAATAAAGGGTGTTGCTGTCAAGGCTGA

Publications

PMID - Link Title