Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Gene Name Dpm3
Plot displaying the genomic locations of a parental gene (in chr2) and its retrocopy(ies). Each line represents a retrocopy.
Specie Rattus norvegicus
Full Name dolichyl-phosphate mannosyltransferase subunit 3, regulatory
Also known as RGD1561807
Coordinate chr2:188583664-188584179
Strand +
Gene summary Predicted to enable enzyme activator activity. Predicted to be involved in GPI anchor biosynthetic process and regulation of protein stability. Predicted to be located in endoplasmic reticulum. Predicted to be part of dolichol-phosphate-mannose synthase complex. Predicted to be integral component of endoplasmic reticulum membrane. Human ortholog(s) of this gene implicated in congenital disorder of glycosylation and muscular dystrophy-dystroglycanopathy. Orthologous to human DPM3 (dolichyl-phosphate mannosyltransferase subunit 3, regulatory). [provided by Alliance of Genome Resources, Apr 2022]

Retrocopy(s) from Dpm3

Retroname Coord Strand Genomic Region ENSG
Dpm3P1 chr15:52919274-52919638 - Intergenic
 N/A UCSC

Expression

Transcript Sequences

>NM_001109331.2
AAAAGGACTTCCGGACGCTGATGCAGGCCTAATTAGCGCGACAGACAGAGCAAACATGACGAAGTTAACACAGTGGCTTTGGGGACTGGCTCTCCTGGGCTCTGCATGGGCTGCCCTGACCATGGGAGCTCTGGGTCTGGAGCTACCTTTACCCTGCCGGGAGGTCCTGTGGCCACTGCCTGCCTATCTGCTGGTGTCCGCTGGCTGCTATGCCCTGGGCACTGTGGGCTATCGCGTAGCTACATTTCACGACTGCGAGGACGCCGCCCGAGAGCTGCAGAGCCAGATCCTGGAGGCCCGAGCTGATTTAGCCCGCAAGGGCCTGCGCTTCTGACACCTGAATCCATTCCAGTTTGGACATCTTTCCCCATTAAAATGCAGTTTTATTTTCTAA