Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name Dpm3P1
Plot displaying the genomic locations of a retrocopy (in chr15) and its respective parental gene (in chr2). Each line represents a retrocopy.
Species Rattus norvegicus
Coordinates chr15:52919274-52919638  UCSC
Strand -
Parental Sequence NM_001109331.2
Parental seq. overlap 357 bp
Parental seq. overlap (%) 90.6%
Genomic Region Intergenic
Retrocopy Summary Dpm3P1, located on chr15:52919274-52919638, is a retrocopy of the parental gene Dpm3. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name Dpm3
Full Name dolichyl-phosphate mannosyltransferase subunit 3, regulatory
Also known as RGD1561807
Coordinate chr2:188583664-188584179
Strand +
Gene summary Predicted to enable enzyme activator activity. Predicted to be involved in GPI anchor biosynthetic process and regulation of protein stability. Predicted to be located in endoplasmic reticulum. Predicted to be part of dolichol-phosphate-mannose synthase complex. Predicted to be integral component of endoplasmic reticulum membrane. Human ortholog(s) of this gene implicated in congenital disorder of glycosylation and muscular dystrophy-dystroglycanopathy. Orthologous to human DPM3 (dolichyl-phosphate mannosyltransferase subunit 3, regulatory). [provided by Alliance of Genome Resources, Apr 2022]

Homology

Species Scientific Name Retrocopy
Human Homo sapiens Without Homology
Chimpanzee Pan troglodytes Without Homology
Bonobo Pan paniscus Without Homology
Gorilla Gorilla gorilla Without Homology
Orangutan Pongo abelii Without Homology
Gibbon Nomascus leucogenys Without Homology
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>Dpm3P1
GCGCGACAGACAGAGCAAACATGACGAAGTTAACACAGTGGCTTTGGGGACTGGCTCTCCTGGGCTCTGCATGGGCTGCCCTGACCATGGGAGCTCTGGGTCTGGAGCTACCTTTACCCTGCCGGGAGGTCCTGTGGCCACTGCCTGCCTATCTGCTGGTGTCCGCTGGCTGCTATGCCCTGGGCACTGTGGGCTATCGCGTAGCTACATTTCACGACTGCGAGGACGCCGCCCGAGAGCTGCAGAGCCAGATCCTGGAGGCCCGAGCTGATTTAGCCCGCAAGGGCCTGCGCTTCTGACACCTGAATCCATTCCAGTTTGGACATCTTTCCCCATTAAAATGCAGTTTTATTTTCT
>NM_001109331.2
AAAAGGACTTCCGGACGCTGATGCAGGCCTAATTAGCGCGACAGACAGAGCAAACATGACGAAGTTAACACAGTGGCTTTGGGGACTGGCTCTCCTGGGCTCTGCATGGGCTGCCCTGACCATGGGAGCTCTGGGTCTGGAGCTACCTTTACCCTGCCGGGAGGTCCTGTGGCCACTGCCTGCCTATCTGCTGGTGTCCGCTGGCTGCTATGCCCTGGGCACTGTGGGCTATCGCGTAGCTACATTTCACGACTGCGAGGACGCCGCCCGAGAGCTGCAGAGCCAGATCCTGGAGGCCCGAGCTGATTTAGCCCGCAAGGGCCTGCGCTTCTGACACCTGAATCCATTCCAGTTTGGACATCTTTCCCCATTAAAATGCAGTTTTATTTTCTAA

Publications

PMID - Link Title