Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Gene Name NOP10
Plot displaying the genomic locations of a parental gene (in chr15) and its retrocopy(ies). Each line represents a retrocopy.
Specie Homo sapiens
Full Name NOP10 ribonucleoprotein
Also known as DKCB1|NOLA3|NOP10P
Coordinate chr15:34341719-34343136
Strand -
Gene summary This gene is a member of the H/ACA snoRNPs (small nucleolar ribonucleoproteins) gene family. snoRNPs are involved in various aspects of rRNA processing and modification and have been classified into two families: C/D and H/ACA. The H/ACA snoRNPs also include the DKC1, NOLA1 and NOLA2 proteins. These four H/ACA snoRNP proteins localize to the dense fibrillar components of nucleoli and to coiled (Cajal) bodies in the nucleus. Both 18S rRNA production and rRNA pseudouridylation are impaired if any one of the four proteins is depleted. The four H/ACA snoRNP proteins are also components of the telomerase complex. This gene encodes a protein related to Saccharomyces cerevisiae Nop10p. [provided by RefSeq, Jul 2008]

Retrocopy(s) from NOP10

Retroname Coord Strand Genomic Region ENSG
NOP10P1 chr12:75964763-75965246 + Intergenic
ENSG00000198923 UCSC

Expression

Transcript Sequences

>NM_018648.4
GTCGGGCGGACCACTGCAGACTGAGCGGTGGACCGAATTGGGACCGCTGGCTTATAAGCGATCATGTTTCTCCAGTATTACCTCAACGAGCAGGGAGATCGAGTCTATACGCTGAAGAAATTTGACCCGATGGGACAACAGACCTGCTCAGCCCATCCTGCTCGGTTCTCCCCAGATGACAAATACTCTCGACACCGAATCACCATCAAGAAACGCTTCAAGGTGCTCATGACCCAGCAACCGCGCCCTGTCCTCTGAGGGTCCCTTAAACTGATGTCTTTTCTGCCACCTGTTACCCCTCGGAGACTCCGTAACCAAACTCTTCGGACTGTGAGCCCTGATGCCTTTTTGCCAGCCATACTCTTTGGCATCCAGTCTCTCGTGGCGATTGATTATGCTTGTGTGAGGCAATCATGGTGGCATCACCCATAAAGGGAACACATTTGACTTTTTTTTCTCATATTTTAAATTACTACAAGATTATTAAAGATAAAATGATTTGAAAAA