Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Gene Name PSMB1
Plot displaying the genomic locations of a parental gene (in chr6) and its retrocopy(ies). Each line represents a retrocopy.
Specie Homo sapiens
Full Name proteasome 20S subunit beta 1
Also known as HC5|NEDMHAL|PMSB1|PSC5
Coordinate chr6:170535120-170553307
Strand -
Gene summary The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is tightly linked to the TBP (TATA-binding protein) gene in human and in mouse, and is transcribed in the opposite orientation in both species. [provided by RefSeq, Jul 2008]

Retrocopy(s) from PSMB1

Retroname Coord Strand Genomic Region ENSG
PSMB1P1 chr2:7736679-7736909 - Intergenic
ENSG00000229405 UCSC

Expression

Transcript Sequences

>NM_002793.4
GTCCGGTCAAGGCAGCCATCTCGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCGTGCGATGTTGTCCTCTACAGCCATGTATTCGGCTCCTGGCAGAGACTTGGGGATGGAACCGCACAGAGCCGCGGGCCCTTTGCAGCTGCGATTTTCGCCCTACGTTTTCAACGGAGGTACTATACTGGCAATTGCTGGAGAAGATTTTGCAATTGTTGCTTCTGATACTCGATTGAGTGAAGGGTTTTCAATTCATACGCGGGATAGCCCCAAATGTTACAAATTAACAGACAAAACAGTCATTGGATGCAGCGGTTTTCATGGAGACTGTCTTACGCTGACAAAGATTATTGAAGCAAGACTAAAGATGTATAAGCATTCCAATAATAAGGCCATGACTACGGGGGCAATTGCTGCAATGCTGTCTACAATCCTGTATTCAAGGCGCTTCTTTCCATACTATGTTTACAACATCATCGGTGGACTTGATGAAGAAGGAAAGGGGGCTGTATACAGCTTTGATCCAGTAGGGTCTTACCAGAGAGACTCCTTCAAGGCTGGAGGCTCAGCAAGTGCCATGCTACAGCCCCTGCTTGACAACCAGGTTGGTTTTAAGAACATGCAGAATGTGGAGCATGTTCCGCTGTCCTTGGACAGAGCCATGCGGCTGGTGAAAGATGTCTTCATTTCTGCGGCTGAGAGAGATGTGTACACTGGGGACGCACTCCGGATCTGCATAGTGACCAAAGAGGGCATCAGGGAGGAAACTGTTTCCTTAAGGAAGGACTGATCTGTGTGCTCTTATCACCAATCAGTTCAGACCTGGTTGATTTTGTACTTTGGAACTGTACCTTGGATGGTTTTGTTTATTAAAAGAGAAACCTGAAGTA