Retrocopy Name | PSMB1P1 |
|
Species | Homo sapiens | |
Coordinates (hg38) | chr2:7736679-7736909 UCSC | |
Coordinates (T2T) | chr2:7760813-7761043 UCSC | |
Coordinates (hg19) | chr2:7876810-7877040 UCSC | |
Strand | - | |
Parental Sequence | NM_002793.4 | |
Parental seq. overlap | 189 bp | |
Parental seq. overlap (%) | 21.2% | |
Genomic Region |
Intergenic |
|
Retrocopy Summary | PSMB1P1, located on chr2:7736679-7736909, is a retrocopy of the parental gene PSMB1. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
Gene Name | PSMB1 |
Full Name | proteasome 20S subunit beta 1 |
Also known as | HC5|NEDMHAL|PMSB1|PSC5 |
Coordinate | chr6:170535120-170553307 |
Strand | - |
Gene summary | The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit. This gene is tightly linked to the TBP (TATA-binding protein) gene in human and in mouse, and is transcribed in the opposite orientation in both species. [provided by RefSeq, Jul 2008] |
Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | PSMB1P1 |
![]() |
Bonobo | Pan paniscus | PSMB1P1 |
![]() |
Gorilla | Gorilla gorilla | PSMB1P1 |
![]() |
Orangutan | Pongo abelii | PSMB1P1 |
![]() |
Gibbon | Nomascus leucogenys | PSMB1P1 |
![]() |
Green monkey | Chlorocebus sabaeus | PSMB1P2 |
![]() |
Crab-eating macaque | Macaca fascicularis | PSMB1P1 |
![]() |
Rhesus | Macaca mulatta | PSMB1P1 |
![]() |
Baboon | Papio anubis | PSMB1P2 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | PSMB1P2 |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
>PSMB1P1 |
AGCCCCAAGTGTTAGAAATTAACAGACTCAGCAGTCACTGGACGCAGTGGTTTTCATGGTGACTGCCTTGTCCTGGCAAAGGTTATTGAAGCAAGACTGAAGAGGCATAAATATTCCAGAAATAAGGTCCTGACTGCAGGGGCCGTTCCTGCAATACTGTCTATGATCCTGTTTTCCAGGCACTTCTTTCCATGCTATGCTTGCATCATCAGTGCCCTTGATGAAGAAGGG |
>NM_002793.4 |
GTCCGGTCAAGGCAGCCATCTCGCCGTGAGACAGCAAGTGTCGGATCCGCAGGCGCAGCCGTGCGATGTTGTCCTCTACAGCCATGTATTCGGCTCCTGGCAGAGACTTGGGGATGGAACCGCACAGAGCCGCGGGCCCTTTGCAGCTGCGATTTTCGCCCTACGTTTTCAACGGAGGTACTATACTGGCAATTGCTGGAGAAGATTTTGCAATTGTTGCTTCTGATACTCGATTGAGTGAAGGGTTTTCAATTCATACGCGGGATAGCCCCAAATGTTACAAATTAACAGACAAAACAGTCATTGGATGCAGCGGTTTTCATGGAGACTGTCTTACGCTGACAAAGATTATTGAAGCAAGACTAAAGATGTATAAGCATTCCAATAATAAGGCCATGACTACGGGGGCAATTGCTGCAATGCTGTCTACAATCCTGTATTCAAGGCGCTTCTTTCCATACTATGTTTACAACATCATCGGTGGACTTGATGAAGAAGGAAAGGGGGCTGTATACAGCTTTGATCCAGTAGGGTCTTACCAGAGAGACTCCTTCAAGGCTGGAGGCTCAGCAAGTGCCATGCTACAGCCCCTGCTTGACAACCAGGTTGGTTTTAAGAACATGCAGAATGTGGAGCATGTTCCGCTGTCCTTGGACAGAGCCATGCGGCTGGTGAAAGATGTCTTCATTTCTGCGGCTGAGAGAGATGTGTACACTGGGGACGCACTCCGGATCTGCATAGTGACCAAAGAGGGCATCAGGGAGGAAACTGTTTCCTTAAGGAAGGACTGATCTGTGTGCTCTTATCACCAATCAGTTCAGACCTGGTTGATTTTGTACTTTGGAACTGTACCTTGGATGGTTTTGTTTATTAAAAGAGAAACCTGAAGTA |
PMID - Link | Title |
---|