Summary

Gene Name	RPS21
Specie	Homo sapiens
Full Name	ribosomal protein S21
Also known as	HLDF|S21
Coordinate	chr20:62386275-62388520
Strand	+
Gene summary	Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S21E family of ribosomal proteins. It is located in the cytoplasm. Alternative splice variants that encode different protein isoforms have been described, but their existence has not been verified. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Retrocopy(s) from RPS21

Retroname	Coord	Strand	Genomic Region	ENSG
RPS21P1	chr1:235432951-235433209	+	Intergenic	ENSG00000229795	UCSC
RPS21P8	chr13:26977568-26977740	+	Intergenic	ENSG00000223782	UCSC
RPS21P13	chr18:46723079-46723265	+	Intragenic	ENSG00000240983	UCSC
RPS21P2	chr2:106288748-106289100	-	Intergenic	ENSG00000230353	UCSC
RPS21P9	chr2:109665646-109665813	+	Intergenic	ENSG00000230603	UCSC
RPS21P4	chr4:16256253-16256601	-	Intergenic	ENSG00000242358	UCSC
RPS21P10	chr4:78768498-78768804	+	Intergenic	ENSG00000239793	UCSC
RPS21P12	chr9:110727399-110727679	-	Intragenic	ENSG00000223918	UCSC
RPS21P11	chr9:34217097-34217237	-	Intragenic	N/A	UCSC

Expression

Transcript Sequences

>NM_001024.4

CCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGACGCCGGCGAGTTCGTGGACCTGTACGTGCCGCGGAAATGCTCCGCTAGCAATCGCATCATCGGTGCCAAGGACCACGCATCCATCCAGATGAACGTGGCCGAGGTTGACAAGGTCACAGGCAGGTTTAATGGCCAGTTTAAAACTTATGCTATCTGCGGGGCCATTCGTAGGATGGGTGAGTCAGATGATTCCATTCTCCGATTGGCCAAGGCCGATGGCATCGTCTCAAAGAACTTTTGACTGGAGAGAATCACAGATGTGGAATATTTGTCATAAATAAATAATGAAAACCTA