Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name RPS21P1
Plot displaying the genomic locations of a retrocopy (in chr1) and its respective parental gene (in chr20). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr1:235432951-235433209  UCSC
Coordinates (T2T) chr1:234828836-234829094  UCSC
Coordinates (hg19) chr1:235596266-235596524  UCSC
Strand +
Parental Sequence NM_001024.4
Parental seq. overlap 219 bp
Parental seq. overlap (%) 60.7%
Genomic Region Intergenic
Retrocopy Summary RPS21P1, located on chr1:235432951-235433209, is a retrocopy of the parental gene RPS21. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name RPS21
Full Name ribosomal protein S21
Also known as HLDF|S21
Coordinate chr20:62386275-62388520
Strand +
Gene summary Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S21E family of ribosomal proteins. It is located in the cytoplasm. Alternative splice variants that encode different protein isoforms have been described, but their existence has not been verified. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes RPS21P1
Bonobo Pan paniscus RPS21P1
Gorilla Gorilla gorilla RPS21P1
Orangutan Pongo abelii RPS21P1
Gibbon Nomascus leucogenys RPS21P3
Green monkey Chlorocebus sabaeus RPS21P7
Crab-eating macaque Macaca fascicularis RPS21P1
Rhesus Macaca mulatta RPS21P1
Baboon Papio anubis RPS21P1
Golden snub-nosed monkey Rhinopithecus roxellana RPS21P2
Marmoset Callithrix jacchus RPS21P7
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>RPS21P1
TGCGCAGTGTGGTGGCAGCAGGCACGGTCTCGACATGCAGAAAGACGCCAGCAAGTTCGTGGATCTGTGCGTGCTGCAGAAATGCTCCACCAGCAACTGCATCATCAGTGCCAAGGACCACACATCCATGCGGATGAACGTGGCCAAGGCCAGTGAGGTCACGGGCAGGTTTAACAGCCAGTTTAAAACCTGTGCTATCTGCAGGACTGTTTGCAGGATGGGTGAGTCAGATGATTCCATTCTCTAATTGGCCATGGCC
>NM_001024.4
CCTTTCTCTCTCGCGCGCGGTGTGGTGGCAGCAGGCGCAGCCCAGCCTCGAAATGCAGAACGACGCCGGCGAGTTCGTGGACCTGTACGTGCCGCGGAAATGCTCCGCTAGCAATCGCATCATCGGTGCCAAGGACCACGCATCCATCCAGATGAACGTGGCCGAGGTTGACAAGGTCACAGGCAGGTTTAATGGCCAGTTTAAAACTTATGCTATCTGCGGGGCCATTCGTAGGATGGGTGAGTCAGATGATTCCATTCTCCGATTGGCCAAGGCCGATGGCATCGTCTCAAAGAACTTTTGACTGGAGAGAATCACAGATGTGGAATATTTGTCATAAATAAATAATGAAAACCTA

Publications

PMID - Link Title