| Gene Name | S100A11 |
|
| Specie | Homo sapiens | |
| Full Name | S100 calcium binding protein A11 | |
| Also known as | HEL-S-43|MLN70|S100C | |
| Coordinate | chr1:152032506-152037004 | |
| Strand | - | |
| Gene summary | The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in motility, invasion, and tubulin polymerization. Chromosomal rearrangements and altered expression of this gene have been implicated in tumor metastasis. [provided by RefSeq, Jul 2008] |
| Retroname | Coord | Strand | Genomic Region | ENSG | |
|---|---|---|---|---|---|
| S100A11P8 | chr11:33450758-33450931 | + |
Intragenic |
ENSG00000255207 | UCSC |
| S100A11P9 | chr11:71505970-71506408 | - |
Intergenic |
ENSG00000254924 | UCSC |
| S100A11P6 | chr1:21768251-21768516 | + |
Intragenic |
ENSG00000231978 | UCSC |
| S100A11P10 | chr12:63651587-63652107 | + |
Intragenic |
ENSG00000257005 | UCSC |
| S100A11P1 | chr7:103261960-103262480 | + |
Intergenic |
ENSG00000237632 | UCSC |
| S100A11P2 | chr7:35169184-35169704 | + |
Intergenic |
ENSG00000236592 | UCSC |
| S100A11P7 | chr7:5560719-5561218 | + |
Intergenic |
ENSG00000228974 | UCSC |
| S100A11P5 | chrX:48177676-48177997 | - |
Intragenic |
ENSG00000238032 | UCSC |
| >NM_005620.2 |
| GAGGAGAGGCTCCAGACCCGCACGCCGCGCGCACAGAGCTCTCAGCGCCGCTCCCAGCCACAGCCTCCCGCGCCTCGCTCAGCTCCAACATGGCAAAAATCTCCAGCCCTACAGAGACTGAGCGGTGCATCGAGTCCCTGATTGCTGTCTTCCAGAAGTATGCTGGAAAGGATGGTTATAACTACACTCTCTCCAAGACAGAGTTCCTAAGCTTCATGAATACAGAACTAGCTGCCTTCACAAAGAACCAGAAGGACCCTGGTGTCCTTGACCGCATGATGAAGAAACTGGACACCAACAGTGATGGTCAGCTAGATTTCTCAGAATTTCTTAATCTGATTGGTGGCCTAGCTATGGCTTGCCATGACTCCTTCCTCAAGGCTGTCCCTTCCCAGAAGCGGACCTGAGGACCCCTTGGCCCTGGCCTTCAAACCCACCCCCTTTCCTTCCAGCCTTTCTGTCATCATCTCCACAGCCCACCCATCCCCTGAGCACACTAACCACCTCATGCAGGCCCCACCTGCCAATAGTAATAAAGCAATGTCACTTTTTTAAAACATGAA |