Summary

Gene Name	S100A11
Specie	Homo sapiens
Full Name	S100 calcium binding protein A11
Also known as	HEL-S-43|MLN70|S100C
Coordinate	chr1:152032506-152037004
Strand	-
Gene summary	The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in motility, invasion, and tubulin polymerization. Chromosomal rearrangements and altered expression of this gene have been implicated in tumor metastasis. [provided by RefSeq, Jul 2008]

Retrocopy(s) from S100A11

Retroname	Coord	Strand	Genomic Region	ENSG
S100A11P8	chr11:33450758-33450931	+	Intragenic	ENSG00000255207	UCSC
S100A11P9	chr11:71505970-71506408	-	Intergenic	ENSG00000254924	UCSC
S100A11P6	chr1:21768251-21768516	+	Intragenic	ENSG00000231978	UCSC
S100A11P10	chr12:63651587-63652107	+	Intragenic	ENSG00000257005	UCSC
S100A11P1	chr7:103261960-103262480	+	Intergenic	ENSG00000237632	UCSC
S100A11P2	chr7:35169184-35169704	+	Intergenic	ENSG00000236592	UCSC
S100A11P7	chr7:5560719-5561218	+	Intergenic	ENSG00000228974	UCSC
S100A11P5	chrX:48177676-48177997	-	Intragenic	ENSG00000238032	UCSC

Expression

Transcript Sequences

>NM_005620.2

GAGGAGAGGCTCCAGACCCGCACGCCGCGCGCACAGAGCTCTCAGCGCCGCTCCCAGCCACAGCCTCCCGCGCCTCGCTCAGCTCCAACATGGCAAAAATCTCCAGCCCTACAGAGACTGAGCGGTGCATCGAGTCCCTGATTGCTGTCTTCCAGAAGTATGCTGGAAAGGATGGTTATAACTACACTCTCTCCAAGACAGAGTTCCTAAGCTTCATGAATACAGAACTAGCTGCCTTCACAAAGAACCAGAAGGACCCTGGTGTCCTTGACCGCATGATGAAGAAACTGGACACCAACAGTGATGGTCAGCTAGATTTCTCAGAATTTCTTAATCTGATTGGTGGCCTAGCTATGGCTTGCCATGACTCCTTCCTCAAGGCTGTCCCTTCCCAGAAGCGGACCTGAGGACCCCTTGGCCCTGGCCTTCAAACCCACCCCCTTTCCTTCCAGCCTTTCTGTCATCATCTCCACAGCCCACCCATCCCCTGAGCACACTAACCACCTCATGCAGGCCCCACCTGCCAATAGTAATAAAGCAATGTCACTTTTTTAAAACATGAA