Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Retrocopy Name S100A11P6
Plot displaying the genomic locations of a retrocopy (in chr1) and its respective parental gene (in chr1). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr1:21768251-21768516  UCSC
Coordinates (T2T) chr1:21592198-21592463  UCSC
Coordinates (hg19) chr1:22094744-22095009  UCSC
Strand +
Parental Sequence NM_005620.2
Parental seq. overlap 224 bp
Parental seq. overlap (%) 39.7%
Genomic Region Intragenic (USP48)
Retrocopy Summary S100A11P6, located on chr1:21768251-21768516, is a retrocopy of the parental gene S100A11. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name S100A11
Full Name S100 calcium binding protein A11
Also known as HEL-S-43|MLN70|S100C
Coordinate chr1:152032506-152037004
Strand -
Gene summary The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in motility, invasion, and tubulin polymerization. Chromosomal rearrangements and altered expression of this gene have been implicated in tumor metastasis. [provided by RefSeq, Jul 2008]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes S100A11P1
Bonobo Pan paniscus S100A11P1
Gorilla Gorilla gorilla S100A11P1
Orangutan Pongo abelii S100A11P1
Gibbon Nomascus leucogenys S100A11P6
Green monkey Chlorocebus sabaeus S100A11P3
Golden snub-nosed monkey Rhinopithecus roxellana S100A11P6
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>S100A11P6
ACCTCACTCAACTCCAATATGGAAAAATTCTCCAGCCCTACAGAGACTGAGCAGTGCATCAAGTCCCTGATTGCTATTTTCCAGGAGGATGCTGGAAAGGATGTCACAACCGCAAACTCTCCAAGAGGGGAGCCCCTCAGTTTCATGAATACAGAACTGGCTGCCCTCACACAGAACCACAAGGACGCTGGTGTCCTTGACCACATGATGAAGAAACTAGACCTCAACTGTGACAGGCAGTTAGATTTCCAAGAATTGCTTAATCT
>NM_005620.2
GAGGAGAGGCTCCAGACCCGCACGCCGCGCGCACAGAGCTCTCAGCGCCGCTCCCAGCCACAGCCTCCCGCGCCTCGCTCAGCTCCAACATGGCAAAAATCTCCAGCCCTACAGAGACTGAGCGGTGCATCGAGTCCCTGATTGCTGTCTTCCAGAAGTATGCTGGAAAGGATGGTTATAACTACACTCTCTCCAAGACAGAGTTCCTAAGCTTCATGAATACAGAACTAGCTGCCTTCACAAAGAACCAGAAGGACCCTGGTGTCCTTGACCGCATGATGAAGAAACTGGACACCAACAGTGATGGTCAGCTAGATTTCTCAGAATTTCTTAATCTGATTGGTGGCCTAGCTATGGCTTGCCATGACTCCTTCCTCAAGGCTGTCCCTTCCCAGAAGCGGACCTGAGGACCCCTTGGCCCTGGCCTTCAAACCCACCCCCTTTCCTTCCAGCCTTTCTGTCATCATCTCCACAGCCCACCCATCCCCTGAGCACACTAACCACCTCATGCAGGCCCCACCTGCCAATAGTAATAAAGCAATGTCACTTTTTTAAAACATGAA

Publications

PMID - Link Title