Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Gene Name MRPS15
Plot displaying the genomic locations of a parental gene (in chr1) and its retrocopy(ies). Each line represents a retrocopy.
Specie Homo sapiens
Full Name mitochondrial ribosomal protein S15
Also known as DC37|MPR-S15|RPMS15|S15mt
Coordinate chr1:36455718-36464384
Strand -
Gene summary Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S15P family. The encoded protein is more than two times the size of its E. coli counterpart, with the 12S rRNA binding sites conserved. Between human and mouse, the encoded protein is the least conserved among small subunit ribosomal proteins. Pseudogenes corresponding to this gene are found on chromosomes 15q and 19q. [provided by RefSeq, Jul 2008]

Retrocopy(s) from MRPS15

Retroname Coord Strand Genomic Region ENSG
MRPS15P1 chr15:73483420-73483743 - Intragenic
ENSG00000259186 UCSC
MRPS15P2 chr19:44290637-44290883 + Intragenic
ENSG00000270679 UCSC

Expression

Transcript Sequences

>NM_031280.4
GCCTCGATTGGTCGATCCTGGGCCAGCATGGCGGCGCCCATGTAACCCGGTCCGTGCCGCAAAGCGAACGGCGGCCGCGGCGCGGGCCCCGCGGGGGTTAGAGGTCACCATGCTGAGGGTCGCGTGGAGGACGCTGAGTTTGATTCGGACCCGGGCAGTTACCCAGGTCCTAGTACCCGGGCTGCCGGGCGGTGGGAGCGCCAAGTTTCCTTTCAACCAGTGGGGCCTGCAGCCTCGAAGTCTCCTCCTCCAGGCCGCGCGCGGATATGTCGTCCGGAAACCAGCCCAGTCTAGGCTGGATGATGACCCACCTCCCTCTACGCTGCTCAAAGACTACCAGAATGTCCCTGGAATTGAGAAGGTTGATGATGTCGTGAAAAGACTCTTGTCTTTGGAAATGGCCAACAAGAAGGAGATGCTAAAAATCAAGCAAGAACAGTTTATGAAGAAGATTGTTGCAAACCCAGAGGACACCAGATCCCTGGAGGCTCGAATTATTGCCTTGTCTGTCAAGATCCGCAGTTATGAAGAACACTTGGAGAAACATCGAAAGGACAAAGCCCACAAACGCTATCTGCTAATGAGCATTGACCAGAGGAAAAAGATGCTCAAAAACCTCCGTAACACCAACTATGATGTCTTTGAGAAGATATGCTGGGGGCTGGGAATTGAGTACACCTTCCCCCCTCTGTATTACCGAAGAGCCCACCGCCGATTCGTGACCAAGAAGGCTCTGTGCATTCGGGTTTTCCAGGAGACTCAAAAGCTGAAGAAGCGAAGAAGAGCCTTAAAGGCTGCAGCAGCAGCCCAAAAACAAGCAAAGCGGAGGAACCCAGACAGCCCTGCCAAAGCCATACCAAAGACACTCAAAGACAGCCAATAAATTCTGTTCAATCATTTCTTTCTGTCTTGAAGAATGATAGGAGAGATGATGGGGCTCTTTTTGGCCTGAA