| Retrocopy Name | MRPS15P1 |
|
| Species | Homo sapiens | |
| Coordinates (hg38) | chr15:73483420-73483743 UCSC | |
| Coordinates (T2T) | chr15:71300554-71300877 UCSC | |
| Coordinates (hg19) | chr15:73775761-73776084 UCSC | |
| Strand | - | |
| Parental Sequence | NM_031280.4 | |
| Parental seq. overlap | 268 bp | |
| Parental seq. overlap (%) | 28.1% | |
| Genomic Region |
Intragenic (REC114) |
|
| Retrocopy Summary | MRPS15P1, located on chr15:73483420-73483743, is a retrocopy of the parental gene MRPS15. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes. |
| Gene Name | MRPS15 |
| Full Name | mitochondrial ribosomal protein S15 |
| Also known as | DC37|MPR-S15|RPMS15|S15mt |
| Coordinate | chr1:36455718-36464384 |
| Strand | - |
| Gene summary | Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that belongs to the ribosomal protein S15P family. The encoded protein is more than two times the size of its E. coli counterpart, with the 12S rRNA binding sites conserved. Between human and mouse, the encoded protein is the least conserved among small subunit ribosomal proteins. Pseudogenes corresponding to this gene are found on chromosomes 15q and 19q. [provided by RefSeq, Jul 2008] |
| Species | Scientific Name | Retrocopy | |
![]() |
Chimpanzee | Pan troglodytes | MRPS15P1 |
![]() |
Bonobo | Pan paniscus | MRPS15P1 |
![]() |
Gorilla | Gorilla gorilla | MRPS15P1 |
![]() |
Orangutan | Pongo abelii | MRPS15P1 |
![]() |
Gibbon | Nomascus leucogenys | MRPS15P1 |
![]() |
Green monkey | Chlorocebus sabaeus | MRPS15P3 |
![]() |
Crab-eating macaque | Macaca fascicularis | MRPS15P2 |
![]() |
Rhesus | Macaca mulatta | MRPS15P2 |
![]() |
Baboon | Papio anubis | MRPS15P2 |
![]() |
Golden snub-nosed monkey | Rhinopithecus roxellana | Without Homology |
![]() |
Marmoset | Callithrix jacchus | Without Homology |
![]() |
Mouse lemur | Microcebus murinus | Without Homology |
![]() |
Mouse | Mus musculus | Without Homology |
![]() |
Rat | Rattus norvegicus | Without Homology |
![]() |
Chinese hamster | Cricetulus griseus | Without Homology |
![]() |
Rabbit | Oryctolagus cuniculus | Without Homology |
![]() |
Pig | Sus scrofa | Without Homology |
![]() |
Cow | Bos taurus | Without Homology |
![]() |
Sheep | Ovis aries | Without Homology |
![]() |
Dolphin | Tursiops truncatus | Without Homology |
![]() |
Horse | Equus caballus | Without Homology |
![]() |
Dog | Canis familiaris | Without Homology |
![]() |
Panda | Ailuropoda melanoleuca | Without Homology |
![]() |
Cat | Felis catus | Without Homology |
![]() |
Pale spear-nosed bat | Phyllostomus discolor | Without Homology |
![]() |
Velvety free-tailed bat | Molossus molossus | Without Homology |
![]() |
Greater mouse-eared bat | Myotis myotis | Without Homology |
![]() |
Kuhl's pipistrelle | Pipistrellus kuhlii | Without Homology |
![]() |
Greater horseshoe bat | Rhinolophus ferrumequinum | Without Homology |
![]() |
Egyptian rousette | Rousettus aegyptiacus | Without Homology |
![]() |
Sloth | Choloepus didactylus | Without Homology |
![]() |
Tasmanian Devil | Sarcophilus harrisii | Without Homology |
![]() |
Opossum | Monodelphis domestica | Without Homology |
![]() |
Platypus | Ornithorhynchus anatinus | Without Homology |
![]() |
Chicken | Gallus gallus | Without Homology |
![]() |
Turkey | Meleagris gallopavo | Without Homology |
![]() |
Zebra Finch | Taeniopygia guttata | Without Homology |
![]() |
Budgerigar | Melopsittacus undulatus | Without Homology |
![]() |
Painted Turtle | Chrysemys picta | Without Homology |
![]() |
Lizard | Anolis Carolinensis | Without Homology |
![]() |
Frog | Xenopus tropicalis | Without Homology |
![]() |
Zebrafish | Danio rerio | Without Homology |
![]() |
Drosophila | Drosophila melanogaster | Without Homology |
| >MRPS15P1 |
| GCTGCTCAAAGACCACCAGACCATCCCTGGAATTGAGAAGGGCAATGATACAGTGAAAAGATCCTTGTCTTTGGAAATGACCAACCAAAAGGAGAAGCTAAATATCAAGTAAGAACATCTGATGAACAAAGTCGTGGCAAACCCTAAGGACACCAGCTTCCTGGAGGCTCGAATTATTCCCTTGACCAAAGCCCACAATTATGAAGAACACAGCAGAAACACTGAAATAACAAAACCCACAAATACTATTGGTGATGGGCACTGTCCAGAGGAAAAAGATGCTCAAAAACCTTCGTTAGACCAATATGATGTCTCTGAGAAGAC |
| >NM_031280.4 |
| GCCTCGATTGGTCGATCCTGGGCCAGCATGGCGGCGCCCATGTAACCCGGTCCGTGCCGCAAAGCGAACGGCGGCCGCGGCGCGGGCCCCGCGGGGGTTAGAGGTCACCATGCTGAGGGTCGCGTGGAGGACGCTGAGTTTGATTCGGACCCGGGCAGTTACCCAGGTCCTAGTACCCGGGCTGCCGGGCGGTGGGAGCGCCAAGTTTCCTTTCAACCAGTGGGGCCTGCAGCCTCGAAGTCTCCTCCTCCAGGCCGCGCGCGGATATGTCGTCCGGAAACCAGCCCAGTCTAGGCTGGATGATGACCCACCTCCCTCTACGCTGCTCAAAGACTACCAGAATGTCCCTGGAATTGAGAAGGTTGATGATGTCGTGAAAAGACTCTTGTCTTTGGAAATGGCCAACAAGAAGGAGATGCTAAAAATCAAGCAAGAACAGTTTATGAAGAAGATTGTTGCAAACCCAGAGGACACCAGATCCCTGGAGGCTCGAATTATTGCCTTGTCTGTCAAGATCCGCAGTTATGAAGAACACTTGGAGAAACATCGAAAGGACAAAGCCCACAAACGCTATCTGCTAATGAGCATTGACCAGAGGAAAAAGATGCTCAAAAACCTCCGTAACACCAACTATGATGTCTTTGAGAAGATATGCTGGGGGCTGGGAATTGAGTACACCTTCCCCCCTCTGTATTACCGAAGAGCCCACCGCCGATTCGTGACCAAGAAGGCTCTGTGCATTCGGGTTTTCCAGGAGACTCAAAAGCTGAAGAAGCGAAGAAGAGCCTTAAAGGCTGCAGCAGCAGCCCAAAAACAAGCAAAGCGGAGGAACCCAGACAGCCCTGCCAAAGCCATACCAAAGACACTCAAAGACAGCCAATAAATTCTGTTCAATCATTTCTTTCTGTCTTGAAGAATGATAGGAGAGATGATGGGGCTCTTTTTGGCCTGAA |
| PMID - Link | Title |
|---|