Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Gene Name SEM1
Plot displaying the genomic locations of a parental gene (in chr7) and its retrocopy(ies). Each line represents a retrocopy.
Specie Homo sapiens
Full Name SEM1 26S proteasome subunit
Also known as C7orf76|DSS1|ECD|PSMD15|SHFD1|SHFM1|SHSF1|Shfdg1
Coordinate chr7:96484175-96709846
Strand -
Gene summary The product of this gene has been localized within the split hand/split foot malformation locus SHFM1 at chromosome 7. It has been proposed to be a candidate gene for the autosomal dominant form of the heterogeneous limb developmental disorder split hand/split foot malformation type 1. In addition, it has been shown to directly interact with BRCA2. It also may play a role in the completion of the cell cycle. [provided by RefSeq, Jul 2008]

Retrocopy(s) from SEM1

Retroname Coord Strand Genomic Region ENSG
SEM1P1 chr5:81892449-81892885 + Intergenic
ENSG00000214857 UCSC

Expression

Transcript Sequences

>NM_006304.2
AGTGACGGTGGCGTTTCCTTGAGGAAGAGTGAGGGTTCCAACTTTTCTGCTTATCTGGGAGGTGTTGGGCGCGGACAGTCGAGATGTCAGAGAAAAAGCAGCCGGTAGACTTAGGTCTGTTAGAGGAAGACGACGAGTTTGAAGAGTTCCCTGCCGAAGACTGGGCTGGCTTAGATGAAGATGAAGATGCACATGTCTGGGAGGATAATTGGGATGATGACAATGTAGAGGATGACTTCTCTAATCAGTTACGAGCTGAACTAGAGAAACATGGTTATAAGATGGAGACTTCATAGCATCCAGAAGAAGTGTTGAAGTAACCTAAACTTGACCTGCTTAATACATTCTAGGGCAGAGAACCCAGGATGGGACACTAAAAAAATGTGTTTATTTCATTATCTGCTTGGATTTATTTGTGTTTTTGTAACACAAAAAATAAATGTTTTGATATAATCTTG