Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Gene Name SNURF
Plot displaying the genomic locations of a parental gene (in chr15) and its retrocopy(ies). Each line represents a retrocopy.
Specie Homo sapiens
Full Name SNRPN upstream open reading frame
Also known as -
Coordinate chr15:24954987-24978723
Strand +
Gene summary This gene is located within the Prader-Willi Syndrome critical region on chromosome 15. Transcripts produced from this gene initiate at an imprinting center and are paternally-imprinted. These transcripts may be bicistronic and also encode SNRPN (small nuclear ribonucleoprotein polypeptide N) from a downstream open reading frame. The small protein represented by this gene is encoded by an evolutionarily-conserved upstream open reading frame and is localized to the nucleus. Extensive alternative splicing and promoter usage occurs in this region and the full-length nature of some of these transcripts has not been determined. Alterations in the imprinting center are associated with parental imprint switch failure, which may cause Angelman syndrome or Prader-Willi syndrome. [provided by RefSeq, Mar 2017]

Retrocopy(s) from SNURF

Retroname Coord Strand Genomic Region ENSG
SNURFP1 chrX:130330836-130331127 + Intergenic
ENSG00000225046 UCSC
SNURFL chrX:139362087-139362358 + Intergenic
ENSG00000173954 UCSC

Expression

Transcript Sequences

>NM_022804.3
GCAGAGTGGAGCGGCCGCCGGAGATGCCTGACGCATCTGTCTGAGGAGCGGTCAGTGACGCGATGGAGCGGGCAAGGGATCGCTTACACCTGAGACGAACTACAGAACAGCACGTACCAGAGGTGGAAGTCCAAGTCAAACGCAGAAGGACTGCCTCACTGAGCAACCAAGAGTGTCAGTTGTACCCGAGGCGTTCTCAGCAGCAGCAAGTACCTGTGGTGGATTTCCAGGCTGAACTGAGGCAGGCATTCTTAGCTGAGACACCAAGAGGTGGTTAAAGCCATATTGGAGTAGCGAGGAATCTGATTCCAAGCAAAAACCAGACAATGTAATAAAAATATTATTCATAA