Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name SNURFL
Plot displaying the genomic locations of a retrocopy (in chrX) and its respective parental gene (in chr15). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chrX:139362087-139362358  UCSC
Coordinates (T2T) chrX:137672110-137672381  UCSC
Coordinates (hg19) chrX:138444246-138444517  UCSC
Strand +
Parental Sequence NM_022804.3
Parental seq. overlap 232 bp
Parental seq. overlap (%) 66.1%
Genomic Region Intergenic
Retrocopy Summary SNURFL, located on chrX:139362087-139362358, is a retrocopy of the parental gene SNURF. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name SNURF
Full Name SNRPN upstream open reading frame
Also known as -
Coordinate chr15:24954987-24978723
Strand +
Gene summary This gene is located within the Prader-Willi Syndrome critical region on chromosome 15. Transcripts produced from this gene initiate at an imprinting center and are paternally-imprinted. These transcripts may be bicistronic and also encode SNRPN (small nuclear ribonucleoprotein polypeptide N) from a downstream open reading frame. The small protein represented by this gene is encoded by an evolutionarily-conserved upstream open reading frame and is localized to the nucleus. Extensive alternative splicing and promoter usage occurs in this region and the full-length nature of some of these transcripts has not been determined. Alterations in the imprinting center are associated with parental imprint switch failure, which may cause Angelman syndrome or Prader-Willi syndrome. [provided by RefSeq, Mar 2017]

Homology

Species Scientific Name Retrocopy
Bonobo Pan paniscus SNURFP2
Gorilla Gorilla gorilla SNURFP2
Orangutan Pongo abelii SNURFP4
Gibbon Nomascus leucogenys SNURFP3
Green monkey Chlorocebus sabaeus SNURFP1
Baboon Papio anubis SNURFP1
Golden snub-nosed monkey Rhinopithecus roxellana SNURFP1
Chimpanzee Pan troglodytes Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

Related Sequence

>SNURFL
AGTCAGTGAGGCAATGGAGCAAGCAAGGGATCACTTACACCTGAGATGGACTACAGAACAGCACATGCCCGAGGTGGAAGTTCAAGTCAAATACAGAACAGCTGCACTGAGCAACCAAGAGTGTCAATTGTACCTGAGGCATTCTCAGCAGCAGCAAGTGCTTGTGGTGGATTTCCAGGCCAAACTGAGACAGGTATTCATAACTGAGACACCAAGATGTGGTAAAAAGCCGTACTGGAACAATGAGGAAGCTGAATCCAAGCAAAATCCAG
>NM_022804.3
GCAGAGTGGAGCGGCCGCCGGAGATGCCTGACGCATCTGTCTGAGGAGCGGTCAGTGACGCGATGGAGCGGGCAAGGGATCGCTTACACCTGAGACGAACTACAGAACAGCACGTACCAGAGGTGGAAGTCCAAGTCAAACGCAGAAGGACTGCCTCACTGAGCAACCAAGAGTGTCAGTTGTACCCGAGGCGTTCTCAGCAGCAGCAAGTACCTGTGGTGGATTTCCAGGCTGAACTGAGGCAGGCATTCTTAGCTGAGACACCAAGAGGTGGTTAAAGCCATATTGGAGTAGCGAGGAATCTGATTCCAAGCAAAAACCAGACAATGTAATAAAAATATTATTCATAA

Publications

PMID - Link Title