Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Advanced Search

Summary

Gene Name PDCD5
Plot displaying the genomic locations of a parental gene (in chr19) and its retrocopy(ies). Each line represents a retrocopy.
Specie Homo sapiens
Full Name programmed cell death 5
Also known as TFAR19
Coordinate chr19:32581190-32587453
Strand +
Gene summary This gene encodes a protein that is upregulated during apoptosis where it translocates rapidly from the cytoplasm to the nucleus. The encoded protein may be an important regulator of K(lysine) acetyltransferase 5 (a protein involved in transcription, DNA damage response and cell cycle control) by inhibiting its proteasome-dependent degradation. Pseudogenes have been identified on chromosomes 5 and 12 [provided by RefSeq, Dec 2010]

Retrocopy(s) from PDCD5

Retroname Coord Strand Genomic Region ENSG
PDCD5P1 chr12:19413151-19413588 + Intragenic
 ENSG00000255909 UCSC
PDCD5P2 chr5:76280957-76281401 + Intragenic
 ENSG00000251107 UCSC

Expression

Transcript Sequences

>NM_004708.4
AGTGGTCAAGGCCGCGCTCGCGCCGAGGGGCTGCGAGAGTGACCGCGGCTGCTCCAGCGCTGACGCCGAGCCATGGCGGACGAGGAGCTTGAGGCGCTGAGGAGACAGAGGCTGGCCGAGCTGCAGGCCAAACACGGGGATCCTGGTGATGCGGCCCAACAGGAAGCAAAGCACAGGGAAGCAGAAATGAGAAACAGTATCTTAGCCCAAGTTCTGGATCAGTCGGCCCGGGCCAGGTTAAGTAACTTAGCACTTGTAAAGCCTGAAAAAACTAAAGCAGTAGAGAATTACCTTATACAGATGGCAAGATATGGACAACTAAGTGAGAAGGTATCAGAACAAGGTTTAATAGAAATCCTTAAAAAAGTAAGCCAACAAACAGAAAAGACAACAACAGTGAAATTCAACAGAAGAAAAGTAATGGACTCTGATGAAGATGACGATTATTGAACTACAAGTGCTCACAGACTAGAACTTAACGGAACAAGTCTAGGACAGAAGTTAAGATCTGATTATTTACTTTGTTTATTGTCTATATGCCTTTTAAAAAAATAAACTTGTTATGCAAAATAAAACATTTGGGTAAGTTGTTTTAGTATCATA