Imagem 1

Example: RPL12P6, GAPDH, ENSG00000237984

Summary

Retrocopy Name PDCD5P1
Wait
Plot displaying the genomic locations of a retrocopy (in chr12) and its respective parental gene (in chr19). Each line represents a retrocopy.
Species Homo sapiens
Coordinates (hg38) chr12:19413151-19413588  UCSC
Coordinates (T2T) chr12:19289928-19290365  UCSC
Coordinates (hg19) chr12:19566085-19566522  UCSC
Strand +
Parental Sequence NM_004708.4
Parental seq. overlap 417 bp
Parental seq. overlap (%) 68.6%
Genomic Region Intragenic (AEBP2)
Retrocopy Summary PDCD5P1, located on chr12:19413151-19413588, is a retrocopy of the parental gene PDCD5. Retrocopies of protein-coding genes, also known as processed pseudogenes, are intriguing genomic elements with implications in genome evolution and diseases. While some retrocopies are non-functional, there are examples of retrocopies (retrogenes) acquiring regulatory roles or exhibiting neofunctionalization unrelated to their parental genes.

Parental Gene

Gene Name PDCD5
Full Name programmed cell death 5
Also known as TFAR19
Coordinate chr19:32581190-32587453
Strand +
Gene summary This gene encodes a protein that is upregulated during apoptosis where it translocates rapidly from the cytoplasm to the nucleus. The encoded protein may be an important regulator of K(lysine) acetyltransferase 5 (a protein involved in transcription, DNA damage response and cell cycle control) by inhibiting its proteasome-dependent degradation. Pseudogenes have been identified on chromosomes 5 and 12 [provided by RefSeq, Dec 2010]

Homology

Species Scientific Name Retrocopy
Chimpanzee Pan troglodytes PDCD5P2
Bonobo Pan paniscus PDCD5P2
Gorilla Gorilla gorilla PDCD5P1
Orangutan Pongo abelii PDCD5P2
Gibbon Nomascus leucogenys PDCD5P3
Green monkey Chlorocebus sabaeus Without Homology
Crab-eating macaque Macaca fascicularis Without Homology
Rhesus Macaca mulatta Without Homology
Baboon Papio anubis Without Homology
Golden snub-nosed monkey Rhinopithecus roxellana Without Homology
Marmoset Callithrix jacchus Without Homology
Mouse lemur Microcebus murinus Without Homology
Mouse Mus musculus Without Homology
Rat Rattus norvegicus Without Homology
Chinese hamster Cricetulus griseus Without Homology
Rabbit Oryctolagus cuniculus Without Homology
Pig Sus scrofa Without Homology
Cow Bos taurus Without Homology
Sheep Ovis aries Without Homology
Dolphin Tursiops truncatus Without Homology
Horse Equus caballus Without Homology
Dog Canis familiaris Without Homology
Panda Ailuropoda melanoleuca Without Homology
Cat Felis catus Without Homology
Pale spear-nosed bat Phyllostomus discolor Without Homology
Velvety free-tailed bat Molossus molossus Without Homology
Greater mouse-eared bat Myotis myotis Without Homology
Kuhl's pipistrelle Pipistrellus kuhlii Without Homology
Greater horseshoe bat Rhinolophus ferrumequinum Without Homology
Egyptian rousette Rousettus aegyptiacus Without Homology
Sloth Choloepus didactylus Without Homology
Tasmanian Devil Sarcophilus harrisii Without Homology
Opossum Monodelphis domestica Without Homology
Platypus Ornithorhynchus anatinus Without Homology
Chicken Gallus gallus Without Homology
Turkey Meleagris gallopavo Without Homology
Zebra Finch Taeniopygia guttata Without Homology
Budgerigar Melopsittacus undulatus Without Homology
Painted Turtle Chrysemys picta Without Homology
Lizard Anolis Carolinensis Without Homology
Frog Xenopus tropicalis Without Homology
Zebrafish Danio rerio Without Homology
Drosophila Drosophila melanogaster Without Homology

Expression

The Genotype-Tissue Expression project - (GTEx)

Adipose SubcutaneousMuscle SkeletalArtery TibialArtery CoronaryHeart Atrial AppendageAdipose VisceralUterusVaginaBreast Mammary TissueSkin Not Sun ExposedMinor Salivary GlandBrain CortexAdrenal GlandThyroidLungSpleenPancreasEsophagus MuscularisEsophagus MucosaEsophagus Gastroesophageal JunctionStomachColon SigmoidSmall Intestine Terminal IleumColon TransverseProstateTestisNerve TibialSkin Sun ExposedHeart Left VentricleBrain CerebellumWhole BloodArtery AortaPituitaryBrain Frontal CortexBrain CaudateBrain Nucleus AccumbensBrain PutamenBrain HypothalamusBrain Spinal CordBrain HippocampusBrain Anterior Cingulate CortexOvaryBrain Cerebellar HemisphereLiverBrain Substantia NigraKidney CortexBrain AmygdalaCervix EctocervixFallopian TubeCervix EndocervixBladderKidney Medulla00.20.40.6
log10(TPM+1)

Related Sequence

>PDCD5P1
AGGATCCTGGCGATGCAGCCCAACAGGAAGCAAAGCACAGGGAAGCAGAAATGAGAAACAGTATCTTAACCCAAGTTTTGGATCAGTCGGCCGGGCCAGGTTTAAGTAACTTAGCACTTGTAAAGCCTGAAAAAACTAAAGCAGTAGAGAATTACCTTATACAGATGGCAAGATATGGACAACTGAGAAGGTGTCAGAACAAGGTTTAATAGAAATCCTTTAAAAAGTAAGCCAACAAACAGAAAAGACAACAACAGTGAAATTCAACAGAAGAAAAGTAATGGACTCTGATGAAGAAGACGATTATTGAACTACAAGTGCTCACAGACTAGAACTTAACAGAACAATTCTAGGACAGAAGTTAAGATCTGATTAAATATTTAGTTTGTTTATTGTCTATATGCCTTTTAAAAAATAAACTTGTTATGCAAAA
>NM_004708.4
AGTGGTCAAGGCCGCGCTCGCGCCGAGGGGCTGCGAGAGTGACCGCGGCTGCTCCAGCGCTGACGCCGAGCCATGGCGGACGAGGAGCTTGAGGCGCTGAGGAGACAGAGGCTGGCCGAGCTGCAGGCCAAACACGGGGATCCTGGTGATGCGGCCCAACAGGAAGCAAAGCACAGGGAAGCAGAAATGAGAAACAGTATCTTAGCCCAAGTTCTGGATCAGTCGGCCCGGGCCAGGTTAAGTAACTTAGCACTTGTAAAGCCTGAAAAAACTAAAGCAGTAGAGAATTACCTTATACAGATGGCAAGATATGGACAACTAAGTGAGAAGGTATCAGAACAAGGTTTAATAGAAATCCTTAAAAAAGTAAGCCAACAAACAGAAAAGACAACAACAGTGAAATTCAACAGAAGAAAAGTAATGGACTCTGATGAAGATGACGATTATTGAACTACAAGTGCTCACAGACTAGAACTTAACGGAACAAGTCTAGGACAGAAGTTAAGATCTGATTATTTACTTTGTTTATTGTCTATATGCCTTTTAAAAAAATAAACTTGTTATGCAAAATAAAACATTTGGGTAAGTTGTTTTAGTATCATA

Publications

PMID - Link Title
No publications available for this retrocopy