| Gene Name | COX6A1 |
|
| Specie | Homo sapiens | |
| Full Name | cytochrome c oxidase subunit 6A1 | |
| Also known as | CMTRID|COX6A|COX6AL | |
| Coordinate | chr12:120438113-120440730 | |
| Strand | + | |
| Gene summary | Cytochrome c oxidase (COX), the terminal enzyme of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. It is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in the electron transfer and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes polypeptide 1 (liver isoform) of subunit VIa, and polypeptide 1 is found in all non-muscle tissues. Polypeptide 2 (heart/muscle isoform) of subunit VIa is encoded by a different gene, and is present only in striated muscles. These two polypeptides share 66% amino acid sequence identity. It has been reported that there may be several pseudogenes on chromosomes 1, 6, 7q21, 7q31-32 and 12. However, only one pseudogene (COX6A1P) on chromosome 1p31.1 has been documented. [provided by RefSeq, Jul 2008] |
| Retroname | Coord | Strand | Genomic Region | ENSG | |
|---|---|---|---|---|---|
| COX6A1P6 | chr11:80957460-80957828 | + |
Intergenic |
ENSG00000254437 | UCSC |
| COX6A1P4 | chr1:80495888-80496422 | + |
Intergenic |
ENSG00000234108 | UCSC |
| COX6A1P3 | chr6:120781173-120781699 | + |
Intergenic |
ENSG00000216710 | UCSC |
| COX6A1P2 | chr6:37044845-37045378 | + |
Intergenic |
ENSG00000226976 | UCSC |
| COX6A1P5 | chr7:123932225-123932468 | + |
Intragenic |
ENSG00000225583 | UCSC |
| >NM_004373.4 |
| AGTCCAGATCAAAAATGGCGGTAGTTGGTGTGTCCTCGGTTTCTCGGCTGCTGGGTCGGTCCCGCCCACAGCTGGGGCGGCCTATGTCGAGTGGCGCCCATGGCGAAGAGGGCTCAGCTCGCATGTGGAAGACTCTCACCTTCTTCGTCGCGCTCCCCGGGGTGGCAGTCAGCATGCTGAATGTGTACCTGAAGTCGCACCACGGAGAGCACGAGAGACCCGAGTTCATCGCCTACCCCCATCTCCGCATCAGGACCAAGCCGTTTCCCTGGGGAGATGGTAACCATACTCTATTCCATAACCCTCATGTGAATCCACTTCCAACTGGCTACGAAGATGAATAAAGAGAATCTGGACCACTACCCGGGCACCAGGGACCACAGCACTGGTTTGGACCGTTACTCTGCACATGGACCAGAAAAAGTATATGGGACCTTAAGCTCACCTTCTTTACTTGTATCAAATGATGACTGGTATACTGGTCTCCCATCCCTTTGCTTGTGGCAGGAGATGGCTTAAATAAATAACTTAAATTTA |